Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SCN1B-sodium channel, voltage-gated, type I, beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCN1B-sodium channel, voltage-gated, type I, beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021266 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCN1B |
| Origin species: | Human |
| Product name: | SCN1B-sodium channel, voltage-gated, type I, beta Gene |
| Size: | 2ug |
| Accessions: | BC021266 |
| Gene id: | 6324 |
| Gene description: | sodium channel, voltage-gated, type I, beta |
| Synonyms: | ATFB13; BRGDA5; GEFSP1; sodium channel subunit beta-1; sodium channel, voltage gated, type I beta subunit; sodium channel, voltage-gated, type I, beta; sodium voltage-gated channel beta subunit 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccttcaaaattctttgcatctcctgcaagcgccgcagcgagaccaacgctgagaccttcaccgagtggaccttccgccagaagggcactgaggagtttgtcaagatcctgcgctatgagaatgaggtgttgcagctggaggaggatgagcgcttcgagggccgcgtggtgtggaatggcagccggggcaccaaagacctgcaggatctgtctatcttcatcaccaatgtcacctacaaccactcgggcgactacgagtgccacgtctaccgcctgctcttcttcgaaaactacgagcacaacaccagcgtcgtcaagaagatccacattgaggtagtggacaaagccaacagagacatggcatccatcgtgtctgagatcatgatgtatgtgctcattgtggtgttgaccatatggctcgtggcagagatgatttactgctacaagaagatcgctgccgccacggagactgctgcacaggagaatgcctcggaatacctggccatcacctctgaaagcaaagagaactgcacgggcgtccaggtggccgaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - WW domain containing adaptor with coiled-coil - fibroblast growth factor binding protein 1 - serine peptidase inhibitor, Kunitz type, 2 - alanyl-tRNA synthetase domain containing 1 |