SCN1B-sodium channel, voltage-gated, type I, beta Gene View larger

SCN1B-sodium channel, voltage-gated, type I, beta Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCN1B-sodium channel, voltage-gated, type I, beta Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SCN1B-sodium channel, voltage-gated, type I, beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021266
Product type: DNA & cDNA
Ncbi symbol: SCN1B
Origin species: Human
Product name: SCN1B-sodium channel, voltage-gated, type I, beta Gene
Size: 2ug
Accessions: BC021266
Gene id: 6324
Gene description: sodium channel, voltage-gated, type I, beta
Synonyms: ATFB13; BRGDA5; GEFSP1; sodium channel subunit beta-1; sodium channel, voltage gated, type I beta subunit; sodium channel, voltage-gated, type I, beta; sodium voltage-gated channel beta subunit 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccttcaaaattctttgcatctcctgcaagcgccgcagcgagaccaacgctgagaccttcaccgagtggaccttccgccagaagggcactgaggagtttgtcaagatcctgcgctatgagaatgaggtgttgcagctggaggaggatgagcgcttcgagggccgcgtggtgtggaatggcagccggggcaccaaagacctgcaggatctgtctatcttcatcaccaatgtcacctacaaccactcgggcgactacgagtgccacgtctaccgcctgctcttcttcgaaaactacgagcacaacaccagcgtcgtcaagaagatccacattgaggtagtggacaaagccaacagagacatggcatccatcgtgtctgagatcatgatgtatgtgctcattgtggtgttgaccatatggctcgtggcagagatgatttactgctacaagaagatcgctgccgccacggagactgctgcacaggagaatgcctcggaatacctggccatcacctctgaaagcaaagagaactgcacgggcgtccaggtggccgaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WW domain containing adaptor with coiled-coil
- fibroblast growth factor binding protein 1
- serine peptidase inhibitor, Kunitz type, 2
- alanyl-tRNA synthetase domain containing 1

Buy SCN1B-sodium channel, voltage-gated, type I, beta Gene now

Add to cart