C9orf97-chromosome 9 open reading frame 97 Gene View larger

C9orf97-chromosome 9 open reading frame 97 Gene

PTXBC022958

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf97-chromosome 9 open reading frame 97 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf97-chromosome 9 open reading frame 97 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022958
Product type: DNA & cDNA
Ncbi symbol: C9orf97
Origin species: Human
Product name: C9orf97-chromosome 9 open reading frame 97 Gene
Size: 2ug
Accessions: BC022958
Gene id: 158427
Gene description: chromosome 9 open reading frame 97
Synonyms: C9orf97; thiosulfate sulfurtransferase/rhodanese-like domain-containing protein 2; PP4189; rhodanese domain-containing protein 2; rhodanese like domain containing 2; thiosulfate sulfurtransferase (rhodanese)-like domain containing 2; thiosulfate sulfurtransferase like domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttttccttcctccccagagtgttcatactgtggagcccgctgggaccagtataaactctgctctactccccagtgccgccagctcgttttgacctgccctgcctgtcaaggacaaggattcacagcctgttgtgtcacatgtcaagacaaggggagcaggaaagtttcaggccctatgcaagacagctttaaagaggaatgcgagtgcacagcccgacggccacgcatacctagggaactcttgcagcatgtgcgacagcctgtgagcccagagccagggcctgatgctgatgaggatgggccagtgcttatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 2 open reading frame 52
- protocadherin gamma subfamily C, 3
- mitochondrial ribosomal protein L51
- chromosome 4 open reading frame 36

Buy C9orf97-chromosome 9 open reading frame 97 Gene now

Add to cart