DSCR8-Down syndrome critical region gene 8 Gene View larger

DSCR8-Down syndrome critical region gene 8 Gene

PTXBC015981

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DSCR8-Down syndrome critical region gene 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DSCR8-Down syndrome critical region gene 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015981
Product type: DNA & cDNA
Ncbi symbol: DSCR8
Origin species: Human
Product name: DSCR8-Down syndrome critical region gene 8 Gene
Size: 2ug
Accessions: BC015981
Gene id: 84677
Gene description: Down syndrome critical region gene 8
Synonyms: C21orf65; CT25.1a; CT25.1b; MMA-1; MMA-1a; MMA-1b; MMA1; MTAG2; Down syndrome critical region gene 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggagcctggacccaactttgttactgtgagaaagggtcttcattcattcaagatggcatttgttaagcacctactacaaaccttggaaatcaagaaagttctggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 8 open reading frame 59
- mitochondrial ribosomal protein L34
- chromosome 9 open reading frame 97
- chromosome 2 open reading frame 52

Buy DSCR8-Down syndrome critical region gene 8 Gene now

Add to cart