C8orf59-chromosome 8 open reading frame 59 Gene View larger

C8orf59-chromosome 8 open reading frame 59 Gene

PTXBC032347

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C8orf59-chromosome 8 open reading frame 59 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C8orf59-chromosome 8 open reading frame 59 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032347
Product type: DNA & cDNA
Ncbi symbol: C8orf59
Origin species: Human
Product name: C8orf59-chromosome 8 open reading frame 59 Gene
Size: 2ug
Accessions: BC032347
Gene id: 401466
Gene description: chromosome 8 open reading frame 59
Synonyms: uncharacterized protein C8orf59; chromosome 8 open reading frame 59
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaagaacaaattaagagggccgaagtccaggaatgtatttcacatagccagccaaaaaaactttaaggctaaaaacaaagcaaaaccagttaccactaatcttaagaaggttcttcatttttcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L34
- chromosome 9 open reading frame 97
- chromosome 2 open reading frame 52
- protocadherin gamma subfamily C, 3

Buy C8orf59-chromosome 8 open reading frame 59 Gene now

Add to cart