C8orf68-chromosome 8 open reading frame 68 Gene View larger

C8orf68-chromosome 8 open reading frame 68 Gene

PTXBC022082

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C8orf68-chromosome 8 open reading frame 68 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C8orf68-chromosome 8 open reading frame 68 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022082
Product type: DNA & cDNA
Ncbi symbol: C8orf68
Origin species: Human
Product name: C8orf68-chromosome 8 open reading frame 68 Gene
Size: 2ug
Accessions: BC022082
Gene id: 619343
Gene description: chromosome 8 open reading frame 68
Synonyms: C8orf68; ERICH1 antisense RNA 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggactgctcaggttttgcctggcattctgcagaagcattgctgtatcttaccagacaggaatacaggccgtctccaaactatagtcctattggactggtgcaccaaatatggatttggggtgtgcgtaattcagtccatagcacccaccaaaccacagaagctgccccgagctgatgtcccgctatcggtgcggctgcaggacactgtcccattgctgcatggagcctctcgctgtctgagcctcacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 8 open reading frame 51
- Down syndrome critical region gene 8
- chromosome 8 open reading frame 59
- mitochondrial ribosomal protein L34

Buy C8orf68-chromosome 8 open reading frame 68 Gene now

Add to cart