LAMC1-laminin, gamma 1 (formerly LAMB2) Gene View larger

LAMC1-laminin, gamma 1 (formerly LAMB2) Gene

PTXBC015586

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LAMC1-laminin, gamma 1 (formerly LAMB2) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LAMC1-laminin, gamma 1 (formerly LAMB2) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015586
Product type: DNA & cDNA
Ncbi symbol: LAMC1
Origin species: Human
Product name: LAMC1-laminin, gamma 1 (formerly LAMB2) Gene
Size: 2ug
Accessions: BC015586
Gene id: 3915
Gene description: laminin, gamma 1 (formerly LAMB2)
Synonyms: LAMB2; laminin subunit gamma-1; S-LAM gamma; S-laminin subunit gamma; laminin B2 chain; laminin, gamma 1 (formerly LAMB2); laminin-10 subunit gamma; laminin-11 subunit gamma; laminin-2 subunit gamma; laminin-3 subunit gamma; laminin-4 subunit gamma; laminin-6 subunit gamma; laminin-7 subunit gamma; laminin-8 subunit gamma; laminin-9 subunit gamma; laminin subunit gamma 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaagcgaagaacatctcacaggatctggaaaaacaagctgcccgagtacatgaggaggccaaaagggccggtgacaaagctgtggagatctatgccagcgtggctcagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome c oxidase subunit VIIc
- coiled-coil domain containing 93
- cytochrome c oxidase subunit VIIb
- coiled-coil domain containing 56

Buy LAMC1-laminin, gamma 1 (formerly LAMB2) Gene now

Add to cart