Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of COX7B-cytochrome c oxidase subunit VIIb Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COX7B-cytochrome c oxidase subunit VIIb Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018386 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COX7B |
| Origin species: | Human |
| Product name: | COX7B-cytochrome c oxidase subunit VIIb Gene |
| Size: | 2ug |
| Accessions: | BC018386 |
| Gene id: | 1349 |
| Gene description: | cytochrome c oxidase subunit VIIb |
| Synonyms: | APLCC; LSDMCA2; cytochrome c oxidase subunit 7B, mitochondrial; cytochrome c oxidase polypeptide VIIb; cytochrome c oxidase subunit VIIb; cytochrome-c oxidase chain VIIb; cytochrome c oxidase subunit 7B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttcccttggtcaaaagcgcactaaatcgtctccaagttcgaagcattcagcaaacaatggcaaggcagagccaccagaaacgtacacctgattttcatgacaaatacggtaatgctgtattagctagtggagccactttctgtattgttacatggacatatgtagcaacacaagtcggaatagaatggaacctgtcccctgttggcagagttaccccaaaggaatggaggaatcagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil domain containing 56 - cytochrome b5 type A (microsomal) - RAB37, member RAS oncogene family - CD151 molecule (Raph blood group) |