COX7B-cytochrome c oxidase subunit VIIb Gene View larger

COX7B-cytochrome c oxidase subunit VIIb Gene

PTXBC018386

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COX7B-cytochrome c oxidase subunit VIIb Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COX7B-cytochrome c oxidase subunit VIIb Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018386
Product type: DNA & cDNA
Ncbi symbol: COX7B
Origin species: Human
Product name: COX7B-cytochrome c oxidase subunit VIIb Gene
Size: 2ug
Accessions: BC018386
Gene id: 1349
Gene description: cytochrome c oxidase subunit VIIb
Synonyms: APLCC; LSDMCA2; cytochrome c oxidase subunit 7B, mitochondrial; cytochrome c oxidase polypeptide VIIb; cytochrome c oxidase subunit VIIb; cytochrome-c oxidase chain VIIb; cytochrome c oxidase subunit 7B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttcccttggtcaaaagcgcactaaatcgtctccaagttcgaagcattcagcaaacaatggcaaggcagagccaccagaaacgtacacctgattttcatgacaaatacggtaatgctgtattagctagtggagccactttctgtattgttacatggacatatgtagcaacacaagtcggaatagaatggaacctgtcccctgttggcagagttaccccaaaggaatggaggaatcagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 56
- cytochrome b5 type A (microsomal)
- RAB37, member RAS oncogene family
- CD151 molecule (Raph blood group)

Buy COX7B-cytochrome c oxidase subunit VIIb Gene now

Add to cart