Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CD151-CD151 molecule (Raph blood group) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD151-CD151 molecule (Raph blood group) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001374 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD151 |
| Origin species: | Human |
| Product name: | CD151-CD151 molecule (Raph blood group) Gene |
| Size: | 2ug |
| Accessions: | BC001374 |
| Gene id: | 977 |
| Gene description: | CD151 molecule (Raph blood group) |
| Synonyms: | CD151 molecule (Raph blood group); hemidesmosomal tetraspanin CD151; CD151 antigen (Raph blood group); CD151 antigen; GP27; MER2; PETA-3; RAPH; SFA1; TSPAN24; membrane glycoprotein SFA-1; platelet surface glycoprotein gp27; platelet-endothelial cell tetraspan antigen 3; platelet-endothelial tetraspan antigen 3; tetraspanin-24; tspan-24 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtgagttcaacgagaagaagacaacatgtggcaccgtttgcctcaagtacctgctgtttacctacaattgctgcttctggctggctggcctggctgtcatggcagtgggcatctggacgctggccctcaagagtgactacatcagcctgctggcctcaggcacctacctggccacagcctacatcctggtggtggcgggcactgtcgtcatggtgactggggtcttgggctgctgcgccaccttcaaggagcgtcggaacctgctgcgcctgtacttcatcctgctcctcatcatctttctgctggagatcatcgctggtatcctcgcctacgcctactaccagcagctgaacacggagctcaaggagaacctgaaggacaccatgaccaagcgctaccaccagccgggccatgaggctgtgaccagcgctgtggaccagctgcagcaggagttccactgctgtggcagcaacaactcacaggactggcgagacagtgagtggatccgctcacaggaggccggtggccgtgtggtcccagacagctgctgcaagacggtggtggctctttgtggacagcgagaccatgcctccaacatctacaaggtggagggcggctgcatcaccaagttggagaccttcatccaggagcacctgagggtcattggggctgtggggatcggcattgcctgtgtgcaggtctttggcatgatcttcacgtgctgcctgtacaggagtctcaagctggagcactactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - FK506 binding protein 11, 19 kDa - coiled-coil domain containing 44 - interleukin 12 receptor, beta 1 - coiled-coil domain containing 49 |