IL12RB1-interleukin 12 receptor, beta 1 Gene View larger

IL12RB1-interleukin 12 receptor, beta 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL12RB1-interleukin 12 receptor, beta 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IL12RB1-interleukin 12 receptor, beta 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029121
Product type: DNA & cDNA
Ncbi symbol: IL12RB1
Origin species: Human
Product name: IL12RB1-interleukin 12 receptor, beta 1 Gene
Size: 2ug
Accessions: BC029121
Gene id: 3594
Gene description: interleukin 12 receptor, beta 1
Synonyms: CD212; IL-12R-BETA1; IL12RB; IMD30; interleukin-12 receptor subunit beta-1; IL-12 receptor beta component; IL-12 receptor subunit beta-1; IL-12R subunit beta-1; cluster of differentiation 212; interleukin 12 receptor, beta 1; interleukin-12 receptor beta-1 chain; interleukin 12 receptor subunit beta 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccgctggtgacctgggtggtccccctcctcttcctcttcctgctgtccaggcagggcgctgcctgcagaaccagtgagtgctgttttcaggacccgccatatccggatgcagactcaggctcggcctcgggccctagggacctgagatgctatcggatatccagtgatcgttacgagtgctcctggcagtatgagggtcccacagctggggtcagccacttcctgcggtgttgccttagctccgggcgctgctgctacttcgccgccggctcagccaccaggctgcagttctccgaccaggctggggtgtctgtgctgtacactgtcacactctgggtggaatcctgggccaggaaccagacagagaagtctcctgaggtcaccctgcagctctacaactcagttaaatatgagcctcctctgggagacatcaaggtgtccaagttggccgggcagctgcgtatggagtgggagaccccggataaccaggttggtgctgaggtgcagttccggcaccggacacccagcagcccatggaagttgggcgactgcggacctcaggatgatgatactgagtcctgcctctgccccctggagatgaatgtggcccaggaattccagctccgacgacggcggctggggagccaaggaagttcctggagcaagtggagcagccctgtgtgcgttccccctgaaaaccccccacagcctcaggtgagattctcggtggagcagctgggccaggatgggaggaggcggctgaccctgaaagagcagccaacccagctggagcttccagaaggctgtcaagggctggcgcctggcacggaggtcacttaccgactacagctccacatgctgtcctgcccgtgtaaggccaaggccaccaggaccctgcacctggggaagatgccctatctctcgggtgctgcctacaacgtggctgtcatctcctcgaaccaatttggtcctggcctgaaccagacgtggcacattcctgccgacacccacacagatggcatgatctcagctcactgcaacctccgccttccagattcaagagattctcctgcttcagcctcccgagtagctgggattacaggcatctgccaccatacccggctaattttgtatttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 49
- coiled-coil domain containing 99
- Ewing sarcoma breakpoint region 1
- keratin associated protein 3-2

Buy IL12RB1-interleukin 12 receptor, beta 1 Gene now

Add to cart