CCDC56-coiled-coil domain containing 56 Gene View larger

CCDC56-coiled-coil domain containing 56 Gene

PTXBC002698

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC56-coiled-coil domain containing 56 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC56-coiled-coil domain containing 56 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002698
Product type: DNA & cDNA
Ncbi symbol: CCDC56
Origin species: Human
Product name: CCDC56-coiled-coil domain containing 56 Gene
Size: 2ug
Accessions: BC002698
Gene id: 28958
Gene description: coiled-coil domain containing 56
Synonyms: CCDC56; COX25; HSPC009; MITRAC12; cytochrome c oxidase assembly factor 3 homolog, mitochondrial; coiled-coil domain-containing protein 56; cytochrome c oxidase assembly protein 3 homolog, mitochondrial; mitochondrial translation regulation assembly intermediate of cytochrome c oxidase protein of 12 kDa; cytochrome c oxidase assembly factor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtcttcgggagctggtgaccctctggattctaagcgtggagaggccccgttcgctcagcgtatcgacccgactcgggagaagctgacacccgagcaactgcattccatgcggcaggcggagcttgcccagtggcagaaggtcctaccacggcggcgaacccggaacatcgtgaccggcctaggcatcggggccctggtgttggctatttatggttacaccttctactcgatttcccaggagcgtttcctagatgagctagaagacgaggccaaagctgcccgagcccgagctctggcaagggcgtcagggtcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome b5 type A (microsomal)
- RAB37, member RAS oncogene family
- CD151 molecule (Raph blood group)
- FK506 binding protein 11, 19 kDa

Buy CCDC56-coiled-coil domain containing 56 Gene now

Add to cart