COX7C-cytochrome c oxidase subunit VIIc Gene View larger

COX7C-cytochrome c oxidase subunit VIIc Gene

PTXBC001005

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COX7C-cytochrome c oxidase subunit VIIc Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COX7C-cytochrome c oxidase subunit VIIc Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001005
Product type: DNA & cDNA
Ncbi symbol: COX7C
Origin species: Human
Product name: COX7C-cytochrome c oxidase subunit VIIc Gene
Size: 2ug
Accessions: BC001005
Gene id: 1350
Gene description: cytochrome c oxidase subunit VIIc
Synonyms: cytochrome c oxidase subunit 7C, mitochondrial; cytochrome c oxidase polypeptide VIIc; cytochrome c oxidase subunit VIIc; cytochrome-c oxidase chain VIIc; cytochrome c oxidase subunit 7C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgggccagagcatccggaggttcacaacctctgtggtccgtaggagccactatgaggagggccctgggaagaatttgccattttcagtggaaaacaagtggtcgttactagctaagatgtgtttgtactttggatctgcatttgctacacccttccttgtagtaagacaccaactgcttaaaacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 93
- cytochrome c oxidase subunit VIIb
- coiled-coil domain containing 56
- cytochrome b5 type A (microsomal)

Buy COX7C-cytochrome c oxidase subunit VIIc Gene now

Add to cart