Login to display prices
Login to display prices
CCDC93-coiled-coil domain containing 93 Gene View larger

CCDC93-coiled-coil domain containing 93 Gene

PTXBC005078

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC93-coiled-coil domain containing 93 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC93-coiled-coil domain containing 93 Gene

Proteogenix catalog: PTXBC005078
Ncbi symbol: CCDC93
Product name: CCDC93-coiled-coil domain containing 93 Gene
Size: 2ug
Accessions: BC005078
Gene id: 54520
Gene description: coiled-coil domain containing 93
Synonyms: coiled-coil domain-containing protein 93; coiled-coil domain containing 93
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccacgccagccttacatccgtccccattgcctgcccatgtccagtggccctgcgcaacaaaagtaagggcttgtcttaccacactctccccagcatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: