Login to display prices
Login to display prices
C18orf45-chromosome 18 open reading frame 45 Gene View larger

C18orf45-chromosome 18 open reading frame 45 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C18orf45-chromosome 18 open reading frame 45 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C18orf45-chromosome 18 open reading frame 45 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006280
Product type: DNA & cDNA
Ncbi symbol: C18orf45
Origin species: Human
Product name: C18orf45-chromosome 18 open reading frame 45 Gene
Size: 2ug
Accessions: BC006280
Gene id: 85019
Gene description: chromosome 18 open reading frame 45
Synonyms: transmembrane protein C18orf45; C18orf45; hVVT; transmembrane protein 241
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctcctgctcggtgcgcttggagaggccttgctggttttctcagagcggaagagctcctgaacaagacggtcaagagaaagactcacaggctgctgcgggagaacagcttgtacacctgtgtacgagcccctggtctcatagctccctgttggatgtgtcagaaagaggaatgcaaggacagtgaggccaggtgggcagtgccatcaccctcacccaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 11 open reading frame 67
- chromosome 10 open reading frame 82
- chromosome 19 open reading frame 42
- chromosome 10 open reading frame 91