C10orf91-chromosome 10 open reading frame 91 Gene View larger

C10orf91-chromosome 10 open reading frame 91 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf91-chromosome 10 open reading frame 91 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf91-chromosome 10 open reading frame 91 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030794
Product type: DNA & cDNA
Ncbi symbol: C10orf91
Origin species: Human
Product name: C10orf91-chromosome 10 open reading frame 91 Gene
Size: 2ug
Accessions: BC030794
Gene id: 170393
Gene description: chromosome 10 open reading frame 91
Synonyms: uncharacterized protein C10orf91; bA432J24.4; chromosome 10 open reading frame 91
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggagtttcctcccaggagctgagagcgtgtccatgggcccagtgcctggcgtgtcctccctgggagcttgctggacgcatgaccaggattctgggagggcagaggacagaccacaggcacccaggataactcagtacacatgggttctcagcttcctgttcacagagaaacctcagacaagaagcacgtcgcccatttctcatcaaggccaaccccagaccacgagagcgctttctctgcgtcagccccagcaccccagcgcccctgcctccgggcgcccgcggcctccgcactccagtggcccagacctggctgaggcagctcccgtggtagatcaagcctcacaggcggctggaagagccagttctgggctgggcctgtgggaacaggcgtctgttagtcagggtttcaggaatgcggccttcgaagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 22, member 23
- RAB, member RAS oncogene family-like 5
- ATPase family, AAA domain containing 4
- chromosome 12 open reading frame 39

Buy C10orf91-chromosome 10 open reading frame 91 Gene now

Add to cart