Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C10orf91-chromosome 10 open reading frame 91 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C10orf91-chromosome 10 open reading frame 91 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030794 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C10orf91 |
| Origin species: | Human |
| Product name: | C10orf91-chromosome 10 open reading frame 91 Gene |
| Size: | 2ug |
| Accessions: | BC030794 |
| Gene id: | 170393 |
| Gene description: | chromosome 10 open reading frame 91 |
| Synonyms: | uncharacterized protein C10orf91; bA432J24.4; chromosome 10 open reading frame 91 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggagtttcctcccaggagctgagagcgtgtccatgggcccagtgcctggcgtgtcctccctgggagcttgctggacgcatgaccaggattctgggagggcagaggacagaccacaggcacccaggataactcagtacacatgggttctcagcttcctgttcacagagaaacctcagacaagaagcacgtcgcccatttctcatcaaggccaaccccagaccacgagagcgctttctctgcgtcagccccagcaccccagcgcccctgcctccgggcgcccgcggcctccgcactccagtggcccagacctggctgaggcagctcccgtggtagatcaagcctcacaggcggctggaagagccagttctgggctgggcctgtgggaacaggcgtctgttagtcagggtttcaggaatgcggccttcgaagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 22, member 23 - RAB, member RAS oncogene family-like 5 - ATPase family, AAA domain containing 4 - chromosome 12 open reading frame 39 |