C11orf67-chromosome 11 open reading frame 67 Gene View larger

C11orf67-chromosome 11 open reading frame 67 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf67-chromosome 11 open reading frame 67 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf67-chromosome 11 open reading frame 67 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002752
Product type: DNA & cDNA
Ncbi symbol: C11orf67
Origin species: Human
Product name: C11orf67-chromosome 11 open reading frame 67 Gene
Size: 2ug
Accessions: BC002752
Gene id: 28971
Gene description: chromosome 11 open reading frame 67
Synonyms: UPF0366 protein C11orf67; C11orf67; CK067; PTD015; mth938 domain-containing protein; adipogenesis associated Mth938 domain-containing protein; adipogenesis associated Mth938 domain containing
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacttcccctgaaattgcttccttatcatgggggcaaatgaaagtaaaaggctctaatacaacctataaggactgcaaagtatggccagggggtagtcggacttgggattggagagaaacaggaactgagcattctcctggtgtgcagcctgcagatgtgaaggaagttgttgagaagggtgtacagactcttgtgattggccgagggatgagtgaggccttgaaggtgccttcatcaactgtggagtacctcaagaaacatggcattgatgtgcgggtcctccagacagagcaggcagtgaaggagtataatgccttggttgcccaaggggtcagggtgggaggtgtcttccattccacctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 10 open reading frame 82
- chromosome 19 open reading frame 42
- chromosome 10 open reading frame 91
- solute carrier family 22, member 23

Buy C11orf67-chromosome 11 open reading frame 67 Gene now

Add to cart