Login to display prices
Login to display prices
C19orf42-chromosome 19 open reading frame 42 Gene View larger

C19orf42-chromosome 19 open reading frame 42 Gene

PTXBC001680

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf42-chromosome 19 open reading frame 42 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf42-chromosome 19 open reading frame 42 Gene

Proteogenix catalog: PTXBC001680
Ncbi symbol: C19orf42
Product name: C19orf42-chromosome 19 open reading frame 42 Gene
Size: 2ug
Accessions: BC001680
Gene id: 79086
Gene description: chromosome 19 open reading frame 42
Synonyms: UPF0608 protein C19orf42; C19orf42; small integral membrane protein 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgagtctccattcctccattcctgatgacttcaagaatgtttttgaccagaaaaccgacaaccttcccagaaagtccaagctcgtggtgggtggaaaagtgttcgccgaggtgtgcatggtttcccagccacgtccctgttttcaaagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: