C19orf42-chromosome 19 open reading frame 42 Gene View larger

C19orf42-chromosome 19 open reading frame 42 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf42-chromosome 19 open reading frame 42 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf42-chromosome 19 open reading frame 42 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001680
Product type: DNA & cDNA
Ncbi symbol: C19orf42
Origin species: Human
Product name: C19orf42-chromosome 19 open reading frame 42 Gene
Size: 2ug
Accessions: BC001680
Gene id: 79086
Gene description: chromosome 19 open reading frame 42
Synonyms: UPF0608 protein C19orf42; C19orf42; small integral membrane protein 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgagtctccattcctccattcctgatgacttcaagaatgtttttgaccagaaaaccgacaaccttcccagaaagtccaagctcgtggtgggtggaaaagtgttcgccgaggtgtgcatggtttcccagccacgtccctgttttcaaagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 10 open reading frame 91
- solute carrier family 22, member 23
- RAB, member RAS oncogene family-like 5
- ATPase family, AAA domain containing 4

Buy C19orf42-chromosome 19 open reading frame 42 Gene now

Add to cart