C10orf82-chromosome 10 open reading frame 82 Gene View larger

C10orf82-chromosome 10 open reading frame 82 Gene

PTXBC021737

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf82-chromosome 10 open reading frame 82 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf82-chromosome 10 open reading frame 82 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021737
Product type: DNA & cDNA
Ncbi symbol: C10orf82
Origin species: Human
Product name: C10orf82-chromosome 10 open reading frame 82 Gene
Size: 2ug
Accessions: BC021737
Gene id: 143379
Gene description: chromosome 10 open reading frame 82
Synonyms: uncharacterized protein C10orf82; chromosome 10 open reading frame 82
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccttccaagaccttcatgagaaacctgccaatcacaccaggctatagcggctttgtgccattcctcagctgccaaggaatgtccaaggaggatgacatgaaccactgtgtgaaaaccttccaggagaaaacacagcgctataaagaacagctgcgggaattgtgctgcgcagtggccactgccccgaaactgaaacctgtcaactccgaggagacggtcctgcaggccctgcaccagtacaatctgcagtaccaccccctgatcctggaatgcaaatatgtaaagaaacctctccaggagcccccgatccctggctgggcaggctacctgccgagagccaaggtcactgaatttggctgtggcacgagatacactgtcatggccaaaaactgctacaaggacttcctggagatcacggagagggccaagaaggcacatctgaaaccatatgaagagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 19 open reading frame 42
- chromosome 10 open reading frame 91
- solute carrier family 22, member 23
- RAB, member RAS oncogene family-like 5

Buy C10orf82-chromosome 10 open reading frame 82 Gene now

Add to cart