Login to display prices
Login to display prices
C10orf82-chromosome 10 open reading frame 82 Gene View larger

C10orf82-chromosome 10 open reading frame 82 Gene

PTXBC021737

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf82-chromosome 10 open reading frame 82 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf82-chromosome 10 open reading frame 82 Gene

Proteogenix catalog: PTXBC021737
Ncbi symbol: C10orf82
Product name: C10orf82-chromosome 10 open reading frame 82 Gene
Size: 2ug
Accessions: BC021737
Gene id: 143379
Gene description: chromosome 10 open reading frame 82
Synonyms: uncharacterized protein C10orf82; chromosome 10 open reading frame 82
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccttccaagaccttcatgagaaacctgccaatcacaccaggctatagcggctttgtgccattcctcagctgccaaggaatgtccaaggaggatgacatgaaccactgtgtgaaaaccttccaggagaaaacacagcgctataaagaacagctgcgggaattgtgctgcgcagtggccactgccccgaaactgaaacctgtcaactccgaggagacggtcctgcaggccctgcaccagtacaatctgcagtaccaccccctgatcctggaatgcaaatatgtaaagaaacctctccaggagcccccgatccctggctgggcaggctacctgccgagagccaaggtcactgaatttggctgtggcacgagatacactgtcatggccaaaaactgctacaaggacttcctggagatcacggagagggccaagaaggcacatctgaaaccatatgaagagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: