C20orf43-chromosome 20 open reading frame 43 Gene View larger

C20orf43-chromosome 20 open reading frame 43 Gene

PTXBC002769

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf43-chromosome 20 open reading frame 43 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf43-chromosome 20 open reading frame 43 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002769
Product type: DNA & cDNA
Ncbi symbol: C20orf43
Origin species: Human
Product name: C20orf43-chromosome 20 open reading frame 43 Gene
Size: 2ug
Accessions: BC002769
Gene id: 51507
Gene description: chromosome 20 open reading frame 43
Synonyms: UPF0549 protein C20orf43; C20orf43; CDAO5; HSPC164; SHUJUN-3; protein RTF2 homolog; replication termination factor 2 domain-containing protein 1; replication termination factor 2 domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggttgcgacgggggaacaatccccaagaggcatgaactggtgaaggggccgaagaaggttgagaaggcaattattggtgggctcctggatggggcctggtcaccagaaacaccaagccaagattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 18 open reading frame 45
- chromosome 11 open reading frame 67
- chromosome 10 open reading frame 82
- chromosome 19 open reading frame 42

Buy C20orf43-chromosome 20 open reading frame 43 Gene now

Add to cart