UTP6-UTP6, small subunit (SSU) processome component, homolog (yeast) Gene View larger

UTP6-UTP6, small subunit (SSU) processome component, homolog (yeast) Gene


New product

Data sheet of UTP6-UTP6, small subunit (SSU) processome component, homolog (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UTP6-UTP6, small subunit (SSU) processome component, homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035325
Product type: DNA & cDNA
Ncbi symbol: UTP6
Origin species: Human
Product name: UTP6-UTP6, small subunit (SSU) processome component, homolog (yeast) Gene
Size: 2ug
Accessions: BC035325
Gene id: 55813
Gene description: UTP6, small subunit (SSU) processome component, homolog (yeast)
Synonyms: UTP6, small subunit processome component; UTP6, small subunit (SSU) processome component, homolog; C17orf40; HCA66; U3 small nucleolar RNA-associated protein 6 homolog; hepatocellular carcinoma-associated antigen 66; multiple hat domains protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagagataattcaggaacgcatagaagatcggctcccggaattggaacagctggagcgcattggactgttcagtcatgcggagattaaggctatcattaagaaggcttccgatctagagtacaaaatccagagaagaacccttttcaaggaagactttatcaattatgttcaatatgaaattaatcttttggagctgatccggagaagaagaacacgcattggatattcatttaagaaggatgagattgagaattctattgtacaccgggtacaaggtgttttccagcgtgcctcagcaaaatggaaagacgatgttcaactttggctctcctatgtggctttttgtaagaagtgggctactaaaactcgacttagcaaggtattctctgccatgttggcgattcattccaacaaaccagctttgtggattatggcagccaaatgggaaatggaagatcgattgtcttcagaaagcgcaaggcaactatttcttcgcgcactgcgctttcatccagagtgcccaaaactttataaagaatactttaggatggagctgatgcatgctgaaaaactgaggaaggagaaggaagaatttgaaaaagccagtatggatgtggagaatcctgattattctgaagaaatccttaagggcgagttggcatggatcatctacaaaaattctgtaagcataattaaaggtgcagaatttcacgtgtcactgctttcgattgcacagctatttgactttgccaaagatctacaaaaagagatttatgatgaccttcaggctctacacacagatgatcctctcacttgggattatgtggcaaggcgagaattagagattgagtcacagacagaagagcagcctacaacgaaacaagccaaagcagtggaggtcggccggaaggaggagaggtgctgtgctgtgtatgaagaggcagtgaagactctgccaacagaggccatgtggaagtgttacatcaccttttgcttggaaagatttactaagaagtcaaatagtgggttccttagagggaagaggttggaaagaaccatgactgtattcaggaaggcacatgaactgaagcttctgtcagaatgccaatacaagcagttgagtgtttcgttgctgtgttataacttcctgagggaagctctggaagtggcagtagctggaactgaattgtttagagactctgggacaatgtggcagctgaagctgcaggtgctgatcgagtcaaagagccctgacatagccatgctttttgaagaagcctttgtgcacctgaaaccccaggtttgtctgccattgtggatttcctgggcagagtggagtgaaggtgccaaaagccaagaagacactgaggcagtctttaagaaagctctcttagctgtcataggtgccgactcagtaaccctgaagaataagtacctggattgggcttatcgaagtggtggctacaaaaaggccagagctgtgtttaaaagtttacaggagagccgaccattttcagttgactttttcaggaaaatgattcagtttgaaaaggagcaagaatcctgcaatatggcgaacataagagaatattatgagagagctttgagagagtttggatccgcagattctgatctttggatggattatatgaaagaagaattgaaccacccccttggtagacctgagaactgtggacagatctactggcgagcgatgaaaatgttgcagggagagtcagcagaggcatttgtagctaaacatgctatgcatcagactggccatttatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 9 (sodium/hydrogen exchanger), member 9
- transcription elongation factor B polypeptide 3B (elongin A2)
- eukaryotic translation initiation factor 1A domain containing
- dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis)

Buy UTP6-UTP6, small subunit (SSU) processome component, homolog (yeast) Gene now

Add to cart