Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DACT3-dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis) Gene
PTXBC034052
New product
Data sheet of DACT3-dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DACT3-dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034052 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DACT3 |
| Origin species: | Human |
| Product name: | DACT3-dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC034052 |
| Gene id: | 147906 |
| Gene description: | dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis) |
| Synonyms: | DAPPER3; RRR1; dapper homolog 3; antagonist of beta-catenin Dapper homolog 3; arginine-rich region 1 protein; dapper, antagonist of beta-catenin, homolog 3; dishevelled binding antagonist of beta catenin 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatccgggccttctcgttcccggtgagccctgagcggggccggctgcggggctggctggagggtagcctggccgggctctgcgagttacattggctccgggagaggcaggagtaccgcgtgcagcaggcgctgcggctggcccagcccggaatggggggcgccgaggccgaggacgaggaggacgccgatgaggatgaagatgcggcggcggcgcgccgggccgcagcggccctggaggagcagctggaggccctgcctggtctcgtctgggacctgggacagcagctgggagacctgagcctggagtctgggggcctggaacaggagagcgggcgtagctcgggcttctatgaagatcccagctctacaggaggtccagattcaccaccctcaaccttctgtggggacagtggcttctctggatccagctcctatggtcgcctgggtccctctgagccccggggcatctatgccagtgagaggcccaagtccctaggtaaggtgggtgagggtggggccctggggccagggaaaggacagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - amiloride binding protein 1 (amine oxidase (copper-containing)) - potassium large conductance calcium-activated channel, subfamily M, beta member 1 - NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) - NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase) |