SLC9A9-solute carrier family 9 (sodium/hydrogen exchanger), member 9 Gene View larger

SLC9A9-solute carrier family 9 (sodium/hydrogen exchanger), member 9 Gene


New product

Data sheet of SLC9A9-solute carrier family 9 (sodium/hydrogen exchanger), member 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC9A9-solute carrier family 9 (sodium/hydrogen exchanger), member 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035779
Product type: DNA & cDNA
Ncbi symbol: SLC9A9
Origin species: Human
Product name: SLC9A9-solute carrier family 9 (sodium/hydrogen exchanger), member 9 Gene
Size: 2ug
Accessions: BC035779
Gene id: 285195
Gene description: solute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms: AUTS16; NHE9; sodium/hydrogen exchanger 9; Na(+)/H(+) exchanger 9; sodium/proton exchanger NHE9; solute carrier family 9 (sodium/hydrogen exchanger); solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9; solute carrier family 9 member A9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagacagtcaagggttatgtcagaaaaggatgagtatcagtttcaacatcagggagcggtggagctgcttgtcttcaattttttgctcatccttaccattttgacaatctggttatttaaaaatcatcgattccgcttcttgcatgaaactggaggagcaatggtgtatggccttataatgggactaattttacgatatgctacagcaccaactgatattgaaagtggaactgtctatgactgtgtaaaactaactttcagtccatcaactctgctggttaatatcactgaccaagtttatgaatataaatacaaaagagaaataagtcagcacaacatcaatcctcatcaaggaaatgctatacttgaaaagatgacatttgatccagaaatcttcttcaatgttttactgccaccaattatatttcatgcaggatatagtctaaagaagagacacttttttcaaaacttaggatctattttaacgtatgccttcttgggaactgccatctcctgcatcgtcatagggttaattatgtatggttttgtgaaggctatgatacatgctggccagctgaaaaatggagactttcatttcactgactgtttattttttggttcactgatgtctgctacagatccagtgacagtgctggccattttccatgaactgcacgtcgaccctgacctgtacacactcttgtttggagagagtgtgttgaatgatgcagtggccatagtccttacatattctatatccatttacagtcccaaggagaatccaaatgcatttgatgccgcagcattcttccagtctgtggggaatttcctgggaatcttcgctggctcatttgcaatggggtctgcgtatgccatcatcacagcactgttgaccaaatttaccaagctgtgtgagttcccgatgctggaaaccggcctgtttttcctgctttcttggagtgccttcctgtctgccgaggctgccggcctaacagggatagttgctgttctcttctgtggagtcacacaagcacattatacctacaacaatctgtcttcggattccaaaataagaactaaacagttgtttgaatttatgaactttttggcggagaacgtcatcttctgttacatgggcctggcactgttcacgttccagaatcatatctttaatgctctttttatacttggagcctttctagcaatttttgttgccagagcctgcaacatatatcccctctccttcctcctgaatctaggccgaaaacagaagatcccctggaactttcagcacatgatgatgttttcaggtttgcgaggagcgatcgcatttgccttagctattcggaacacagaatctcagcccaaacaaatgatgtttaccactacgctgctcctcgtgttcttcactgtctgggtatttggaggaggaacaacccccatgttgacttggcttcagatcagagttggcgtggacctggatgaaaatctgaaggaggacccctcctcacaacaccaggaagcaaataacttggataaaaacatgacgaaagcagagagtgctcggctcttcagaatgtggtatagctttgaccacaagtatctgaaaccaattttaacccactctggtcctccgctgactacaacattacctgaatggtgtggtccgatttccaggctgcttaccagtcctcaagcctatggggaacagctaaaagaggatgatgtggaatgcattgtaaaccaggatgaactagccataaattaccaggagcaagcctcctcaccctgcagtcctcctgcaaggctaggtctggaccagaaagcttcaccccagacgccaggcaaggaaaacatttatgagggagacctcggcctgggaggctatgaactcaagcttgagcaaactttgggtcaatcccagttgaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transcription elongation factor B polypeptide 3B (elongin A2)
- eukaryotic translation initiation factor 1A domain containing
- dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis)
- amiloride binding protein 1 (amine oxidase (copper-containing))