TCEB3B-transcription elongation factor B polypeptide 3B (elongin A2) Gene View larger

TCEB3B-transcription elongation factor B polypeptide 3B (elongin A2) Gene

PTXBC036022

New product

Data sheet of TCEB3B-transcription elongation factor B polypeptide 3B (elongin A2) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TCEB3B-transcription elongation factor B polypeptide 3B (elongin A2) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC036022
Product type: DNA & cDNA
Ncbi symbol: TCEB3B
Origin species: Human
Product name: TCEB3B-transcription elongation factor B polypeptide 3B (elongin A2) Gene
Size: 2ug
Accessions: BC036022
Gene id: 51224
Gene description: transcription elongation factor B polypeptide 3B (elongin A2)
Synonyms: TCEB3B; HsT832; TCEB3L; RNA polymerase II transcription factor SIII subunit A2; transcription elongation factor (SIII) elongin A2 elongin A2; transcription elongation factor B polypeptide 3B; transcription elongation factor B subunit 3B; elongin A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcagggtccactacgctgcacgcagtggagaagctgcaggtacgtctggccactaagacggagccgaaaaagctagagaaatatttgcagaaactctccgccttgcccatgacggcagacatcctggcggagactggaatcagaaagacggtgaagcgcctgcggaagcaccagcacgtgggcgactttgccagagacttagcggcccggtggaagaagctggtgctcgtggaccgaaacacccggcctggcccacaggaccctgaggagagcgcttcccgacagcgcttcggggaggctcttcaggaccaggaaaaggcctggggcttcccagaaaacgcgacggcccccaggagcccatctcacagccctgagcacagacggacagcacgcagaacacctccggggcaacagagacctcacccgaggtctcacagtcgcgagcccagagctgagagaaagtgccccagaatagccccagctgattccggccgctatcgggcctctccaacgcgcacagctcccctccggatgcccgagggccctgagcccgctgcgcccgggaagcaacccggaagaggccacactcacgcggctcagggcgggcctctgctgtgtccaggctgccagggccaaccccaggggaaagccgttgtgagccacagcaaggggcacaaatcgtctcgccaggaaaaacgccccttgtgtgcccagggagattggcactcccctactttgatcagggagaaatcatgcggggcctgcttaagagaggaaaccccaaggatgccctcctgggcaagtgccagggacaggcagccttcggacttcaagacagacaaggaaggggggcaagctggcagcggccagcgtgtccctgccttggaggaggctccagacagtcaccagaagaggcctcagcacagtcactcgaacaagaagaggcccagtctagacggccgggacccaggaaatgggacacacggcctgtcgcccgaggagaaagagcagctttccaacgaccgagagactcaagaggggaagccaccgactgctcatttggacagaacgtccgtgagctccctctctgaggtggaggaggtagatatggctgaggaattcgagcagcccactctgtcatgtgaaaaatacctcacctacgatcagttgcggaagcaaaagaaaaagactggaaaatctgccaccactgcacttggagataaacaaaggaaagcaaacgaatccaagggcactcgtgagtcctgggattcggctaagaaattgcctcctgtccaggaaagccagtcagagaggctgcaggcggccggcgctgattccgccgggccgaaaacggtgcccaaccatgtcttctcagagctctgggacctctcagaggcctggatgcaggccaactacgatccgctttcggattctgactccatgacctcccaggcaaagccagaagcactctcttcaccaaagttccgggaggaagctgctttccctggacgcagagtgaatgctaagatgccggtgtactcgggctccaggcctgcctgccagctccaggtgccgacgctgcgccagcagtgtgcccaggtgcttagaaacaatccggacgccctcagcgacgtgggagaggtcccctactgggttcttgaacctgttctggaagggtggaggcccgatcagctgtatcgcagaaagaaagacaatcacgcactcgttagagagacagacgaattacggaggaatcattgtttccaggacttcaaggaagaaaagccacaggaaaacaaaacttggagggagcagtacctgcggcttccggacgccccagagcagcggctgagagtaatgacaacgaatatccgatctgcacgtggaaacaaccccaacggcagagaggcaaagatgatctgtttcaaatctgtggccaagacgccttatgatacttcaaggaggcaagagaagtctgcaggagacgctgaccccgaaaatggggagatcaagccagcctccaagcccgcgggaagcagccacactccctccagccagagcagcagcggcggtggcagagacagcagcagcagcatccttcgctggctccctgagaagcgggccaacccctgcctgagcagcagcaatgagcacgcggcgcccgcggccaaaacccggaaacaggctgccaagaaagtggccccgctgatggccaaggcaattcgagactacaagagaagattctcccgacgataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 1A domain containing
- dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis)
- amiloride binding protein 1 (amine oxidase (copper-containing))
- potassium large conductance calcium-activated channel, subfamily M, beta member 1

Buy TCEB3B-transcription elongation factor B polypeptide 3B (elongin A2) Gene now

Add to cart