Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EIF1AD-eukaryotic translation initiation factor 1A domain containing Gene
PTXBC005131
New product
Data sheet of EIF1AD-eukaryotic translation initiation factor 1A domain containing Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF1AD-eukaryotic translation initiation factor 1A domain containing Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005131 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF1AD |
| Origin species: | Human |
| Product name: | EIF1AD-eukaryotic translation initiation factor 1A domain containing Gene |
| Size: | 2ug |
| Accessions: | BC005131 |
| Gene id: | 84285 |
| Gene description: | eukaryotic translation initiation factor 1A domain containing |
| Synonyms: | haponin; eukaryotic translation initiation factor 1A domain-containing protein; eukaryotic translation initiation factor 1A domain containing |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctcaggccaccaagaggaagcatgtggtgaaggaggtgctaggggagcacatagtgccctccaaccagcagcagattgtcagggtactcaggaccccagggaacaatctgcatgaggtggagacagcccaagggcagcgcttcctggtgagcatgccctccaaataccgcaagaacatctggatcaagagaggggactttctcattgttgaccccattgaagagggagaaaaggtgaaggctgaaatctcgtttgtgctctgcaaggaccacgtgcgctctctgcagaaggaggggttttggcctgaggccttctctgaagtggctgagaaacacaacaacaggaacagacaaactcaaccagaactcccagctgagccacagttatcaggagaggagtccagctcagaagatgattctgacctgtttgttaacacaaaccgcagacagtatcatgagagtgaggaggagagtgaagaggaggaggcagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis) - amiloride binding protein 1 (amine oxidase (copper-containing)) - potassium large conductance calcium-activated channel, subfamily M, beta member 1 - NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) |