LRRC8E-leucine rich repeat containing 8 family, member E Gene View larger

LRRC8E-leucine rich repeat containing 8 family, member E Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRRC8E-leucine rich repeat containing 8 family, member E Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LRRC8E-leucine rich repeat containing 8 family, member E Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022216
Product type: DNA & cDNA
Ncbi symbol: LRRC8E
Origin species: Human
Product name: LRRC8E-leucine rich repeat containing 8 family, member E Gene
Size: 2ug
Accessions: BC022216
Gene id: 80131
Gene description: leucine rich repeat containing 8 family, member E
Synonyms: volume-regulated anion channel subunit LRRC8E; leucine-rich repeat-containing protein 8E; leucine rich repeat containing 8 family member E
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggacattcctgacgtcaagaatgacttcgccttcatgctgcacctcatcgatcagtacgactccctctactccaagcgcttcgccgtcttcctgtccgaggtcagcgaaagccgtctaaagcagctcaatctcaaccacgagtggacgcccgagaagcttcgacagaagctgcagcgcaatgccgcgggccggctggagctggccctctgcatgctgccgggtctgcccgacaccgtctttgagctcagtgaggtggagtcactcaggctggaggccatctgcgatatcaccttccccccggggctgtcacagctggtgcacttgcaggagctcagcttgctccactcgcccgccaggctacccttctccttgcaggtcttcctgcgggaccacctgaaggtgatgcgcgtcaaatgcgaggagctccgcgaggtgccgctttgggtgtttgggctgcggggcttggaggagctgcacctggaggggcttttcccccaggagctagctcgggcagccaccctggagagcctccgggagctgaagcagctcaaggtgttgtccctccggagcaacgccgggaaggtgccagccagtgtgaccgacgttgctggccacctgcagaggctcagcctgcacaacgatggggcccgtctggttgccctgaacagcctcaagaagctggcggcattgcgggagctggagctggtggcctgcgggctggagcgcatcccccatgcagtgttcagcctgggtgcgctgcaggaacttgacctcaaggacaaccacctgcgctccatcgaggaaatcctcagcttccagcactgccggaagctggtcacgctcaggctgtggcacaaccagatcgcctacgtccctgagcacgtgcggaagctcaggagcctggagcagctctacctcagctacaacaagctggagaccctgccctcccagctcggcctgtgctcaggcctccgtctgctggatgtgtcccacaatgggctacactccctgccacccgaggtgggcctcctgcagaacctacagcacctggccctctcctacaatgccctggaggccctgcccgaagagctcttcttctgccgcaagctgcggacgttgcttctgggcgacaaccagctgagccagctctcgccccacgtgggtgccctcagagccctcagccgcctggagctcaaaggcaaccgcttagaggcgctgccagaagaacttggcaactgtggggggctcaagaaggcggggctcctggtggaagacacgctttaccagggtctgccggcagaagtgcgggacaagatggaggaggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immunoglobulin heavy constant gamma 1 (G1m marker)
- gamma-aminobutyric acid (GABA) A receptor, beta 3
- gamma-aminobutyric acid (GABA) A receptor, beta 1
- CAP, adenylate cyclase-associated protein 1 (yeast)

Buy LRRC8E-leucine rich repeat containing 8 family, member E Gene now

Add to cart