CAP1-CAP, adenylate cyclase-associated protein 1 (yeast) Gene View larger

CAP1-CAP, adenylate cyclase-associated protein 1 (yeast) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CAP1-CAP, adenylate cyclase-associated protein 1 (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CAP1-CAP, adenylate cyclase-associated protein 1 (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013963
Product type: DNA & cDNA
Ncbi symbol: CAP1
Origin species: Human
Product name: CAP1-CAP, adenylate cyclase-associated protein 1 (yeast) Gene
Size: 2ug
Accessions: BC013963
Gene id: 10487
Gene description: CAP, adenylate cyclase-associated protein 1 (yeast)
Synonyms: CAP1-PEN; CAP; adenylyl cyclase-associated protein 1; CAP 1; CAP, adenylate cyclase-associated protein 1; testis secretory sperm-binding protein Li 218p; adenylate cyclase associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgacatgcaaaatctggtagaaagattggagagggcagtgggccgcctggaggcagtatctcatacctctgacatgcaccgtgggtatgcagacagtccttcaaaagcaggagcagctccatatgtgcaggcatttgactcgctgcttgctggtcctgtggcagagtacttgaagatcagtaaagagattgggggagacgtgcagaaacatgcggagatggtccacacaggtttgaagttggagcgagctctgttggttacagcttctcagtgtcaacagccagcagaaaataagctttccgatttgttggcacccatctcagagcagatcaaagaagtgataacctttcgggagaagaaccgaggcagcaagttgtttaatcacctgtcagctgtcagcgaaagtatccaggccctgggctgggtggctatggctcccaagcctggcccttatgtgaaagaaatgaatgatgccgccatgttttatacaaaccgagtcctcaaagagtacaaagatgtggataagaagcatgtagactgggtcaaagcttatttaagtatatggacagagctgcaggcttacattaaggagttccataccaccggactggcctggagcaaaacggggcctgtggcaaaagaactgagcggactgccatctggaccctctgccggatcaggtcctcctccccctccaccaggcccccctcctcccccagtctctaccagttcaggctcagatgagtctgcttcccgctcagcactgttcgcgcagattaatcagggggagagcattacacatgccctgaaacatgtatctgatgacatgaagactcacaagaaccctgccctgaaggctcagagtggtccagtacgcagtggccccaaaccattctctgcacctaaaccccaaaccagcccatcccccaaacgagccacaaagaaggagccagctgtacttgaactggagggcaagaagtggagagtggaaaatcaggaaaatgtttccaacctggtgattgaggacacagagctgaaacaggtggcttacatatacaagtgtgtcaacacgacattgcaaatcaagggcaaaattaactccattacagtagataactgtaagaaacttggcctggtattcgatgacgtggtgggcattgtggagataatcaacagtaaggatgtcaaagttcaggtaatgggtaaagtgccaaccatatccatcaacaaaacagatggctgccatgcttacctgagcaagaattccctggattgtgaaatagtcagtgccaaatcttccgagatgaatgtcctcattcctacagaaggcggtgactttaatgaattcccagttcctgagcagttcaagaccctatggaacgggcagaagttggtcaccacagtgacagaaattgctggataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immunoglobulin heavy constant gamma 1 (G1m marker)
- immunoglobulin heavy constant gamma 1 (G1m marker)
- FAD-dependent oxidoreductase domain containing 1
- fizzy/cell division cycle 20 related 1 (Drosophila)

Buy CAP1-CAP, adenylate cyclase-associated protein 1 (yeast) Gene now

Add to cart