FOXRED1-FAD-dependent oxidoreductase domain containing 1 Gene View larger

FOXRED1-FAD-dependent oxidoreductase domain containing 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FOXRED1-FAD-dependent oxidoreductase domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FOXRED1-FAD-dependent oxidoreductase domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013902
Product type: DNA & cDNA
Ncbi symbol: FOXRED1
Origin species: Human
Product name: FOXRED1-FAD-dependent oxidoreductase domain containing 1 Gene
Size: 2ug
Accessions: BC013902
Gene id: 55572
Gene description: FAD-dependent oxidoreductase domain containing 1
Synonyms: FP634; H17; FAD-dependent oxidoreductase domain-containing protein 1; FAD dependent oxidoreductase domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattcggagggttctgccgcacggcatgggccggggcctcttgacccggaggccaggcacgcgcagaggaggcttttctctggactgggatggaaaggtgtctgagattaagaagaagatcaagtcgatcctgcctggaaggtcctgtgatctactgcaagacaccagccacctgcctcccgagcactcggatgtggtgatcgtgggaggtggggtgcttggcttgtctgtggcctattggctgaagaagctggagagcagacgaggtgctattcgagtgctagtggtggaacgggaccacacgtattcacaggcctccactgggctctcagtaggtgggatttgtcagcagttctcattgcctgagaacatccagctctccctcttttcagccagctttctacggaacatcaatgagtacctggccgtagtcgatgctcctcccctggacctccggttcaacccctcgggctacctcttgctggcttcagaaaaggatgctgcagccatggagagcaacgtgaaagtgcagaggcaggagggagccaaagtttctctgatgtctcctgatcagcttcggaacaagtttccctggataaacacagagggagtggctttggcgtcttatgggatggaggacgaaggttggtttgacccctggtgtctgctccaggggcttcggcgaaaggtccagtccttgggagtccttttctgccagggagaggtgacacgttttgtctcttcatctcaacgcatgttgaccacagatgacaaagcggtggtcttgaaaaggatccatgaagtccatgtgaagatggaccgcagcctggagtaccagcctgtggaatgcgccattgtgatcaacgcagccggagcctggtctgcgcaaatcgcagcactggctggtgttggagaggggccgcctggcaccctgcagggcaccaagctacctgtggagccgaggaaaaggtatgtgtatgtgtggcactgcccccagggaccaggcctagagactccgcttgttccagacaccagtggagcctattttcgccgggaaggattaggtagcaactacctaggtggtcgtagccccactgagcaggaagaaccggacccggcgaacctggaagtggaccatgatttcttccaggacaaggtgtggccccatttggccctgagggtcccagcttttgagactctgaaggttcagagcgcctgggccggctattacgactacaacacctttgaccagaatggcgtggtgggcccccacccgctagttgtcaacatgtactttgctactggcttcagtggtcacgggctccagcaggcccctggcattgggcgagctgtagcagagatggtactgaagggcaggttccagaccatcgacctgagccccttcctctttacccgcttttacttgggagagaagatccaggagaacaacatcatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fizzy/cell division cycle 20 related 1 (Drosophila)
- cAMP responsive element binding protein 3-like 1
- signal-induced proliferation-associated 1 like 2
- E74-like factor 2 (ets domain transcription factor)

Buy FOXRED1-FAD-dependent oxidoreductase domain containing 1 Gene now

Add to cart