ELF2-E74-like factor 2 (ets domain transcription factor) Gene View larger

ELF2-E74-like factor 2 (ets domain transcription factor) Gene

PTXBC034951

New product

Data sheet of ELF2-E74-like factor 2 (ets domain transcription factor) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ELF2-E74-like factor 2 (ets domain transcription factor) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC034951
Product type: DNA & cDNA
Ncbi symbol: ELF2
Origin species: Human
Product name: ELF2-E74-like factor 2 (ets domain transcription factor) Gene
Size: 2ug
Accessions: BC034951
Gene id: 1998
Gene description: E74-like factor 2 (ets domain transcription factor)
Synonyms: EU32; NERF-1A; NERF-1B; NERF-1a,b; NERF-2; ETS-related transcription factor Elf-2; E74-like factor 2 (ets domain transcription factor); ets family transcription factor ELF2C; new Ets-related factor; E74 like ETS transcription factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgacgtctctgcatgagggacccacgaaccagctggatctgctcatccgggccgtggaagcatcagttcacagcagtaatgcacactgtacagataagacaattgaagctgctgaagccctgcttcatatggaatctcctacctgcttgagggattcaagaagtcctgtggaagtgtttgttcctccttgtgtatcaactccagaattcatccatgctgctatgaggccagatgtcattacagaaactgtagtggaggtgtcaactgaagagtctgaacccatggatacctctcctattccaacatcaccagatagccatgaaccaatgaaaaagaaaaaagttggccgtaaaccaaagacccagcaatcaccaatttccaatgggtctcctgagttaggtataaagaagaaaccaagagaaggaaaaggaaacacaacctatttgtgggagtttcttttagatctacttcaagataaaaatacttgtcccaggtatattaaatggactcagagagaaaaaggcatattcaagctggtggattcaaaggctgtctctaagctttggggaaagcataagaacaaaccagacatgaactatgaaaccatgggacgagctttgagatactactaccaaaggggaattcttgcaaaggttgaaggacagaggcttgtatatcagttcaaggatatgccgaaaaacatagtggtcatagatgatgacaaaagtgaaacctgtaatgaagatttagcaggaactactgatgaaaaatcattagaacgagtgtcactgtctgcagaaagtctcctgaaagcagcatcctctgttcgcagtggaaaaaattcatcccctataaactgctccagagcagagaagggtgtagctagagttgtgaatatcacttcccctgggcacgatgcttcatccaggtctcctactaccactgcatctgtgtcagcaacagcagctccaaggacagttcgtgtggcaatgcaggtacctgttgtaatgacatcattgggtcagaaaatttcaactgtggcagttcagtcagttaatgcaggtgcaccattaataaccagcactagtccaacaacagcgacctctccaaaggtagtcattcagacaatccctactgtgatgccagcttctactgaaaatggagacaaaatcaccatgcagcctgccaaaattattaccatcccagctacacagcttgcacagtgtcaactgcagacaaagtcaaatctgactggatcaggaagcattaacattgttggaaccccattggctgtgagagcacttacccctgtttcaatagcccatggtacacctgtaatgagactatcaatgcctactcagcaggcatctggccagactcctcctcgagttatcagtgcagtcataaaggggccagaggttaaatcggaagcagtggcaaaaaagcaagaacatgatgtgaaaactttgcagctagtagaagaaaaaccagcagatggaaataagacagtgacccacgtagtggttgtcagtgcgccttcagctattgcccttcctgtaactatgaaaacagaaggactagtgacatgtgagaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immunoglobulin heavy constant gamma 1 (G1m marker)
- CDC45 cell division cycle 45-like (S. cerevisiae)
- origin recognition complex, subunit 2-like (yeast)
- eukaryotic translation initiation factor 2A, 65kDa

Buy ELF2-E74-like factor 2 (ets domain transcription factor) Gene now

Add to cart