IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene View larger

IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene

PTXBC014258

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014258
Product type: DNA & cDNA
Ncbi symbol: IGHG1
Origin species: Human
Product name: IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene
Size: 2ug
Accessions: BC014258
Gene id: 3500
Gene description: immunoglobulin heavy constant gamma 1 (G1m marker)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggtcaaccgccatcctcgccctcctcctggctgttctccaaggagtctgtgccgaggtgcgcctggagcagtctgggacagaggtgaaaaagccgggggagtctctgaaaatctcctgtcaggcttctggattcacctttaccgactactggatcggctgggtgcgccagctgcccgggcaaggcctggagtggatgggcttcatcgatcgtcttgactctaaaataagatataacccgtccttccaaggccaagtcaccatgtcagccgacacgtcgataaccgccgtctacctgcagtggagccgcctgaaggcctcggacaccggcatctattattgtgcgacctcggatacacctctggactcttactcctttgaattttggggccagggaagcctcgtcatcgtctcctcagcctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcatggaactcaggcgccctgaccagcggcgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcagcttgggcacccagacctacatctgcaacgtgaatcacaagcccagcaacaccaaggtggacaagaaagttgagcccaaatcttgtgacaaaactcacacatgcccaccgtgcccagcacctgaactcctggggggaccgtcagtcttcctcttccccccaaaacccaaggacaccctcatgatctcccggacccctgaggtcacatgcgtggtggtggacgtgagccacgaagaccctgaggtcaagttcaactggtacgtggacggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagtacaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaatggcaaggagtacaagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggatgagctgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctatcccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaacgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gamma-aminobutyric acid (GABA) A receptor, beta 3
- gamma-aminobutyric acid (GABA) A receptor, beta 1
- CAP, adenylate cyclase-associated protein 1 (yeast)
- immunoglobulin heavy constant gamma 1 (G1m marker)

Buy IGHG1-immunoglobulin heavy constant gamma 1 (G1m marker) Gene now

Add to cart