GABRB1-gamma-aminobutyric acid (GABA) A receptor, beta 1 Gene View larger

GABRB1-gamma-aminobutyric acid (GABA) A receptor, beta 1 Gene

PTXBC022449

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GABRB1-gamma-aminobutyric acid (GABA) A receptor, beta 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GABRB1-gamma-aminobutyric acid (GABA) A receptor, beta 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022449
Product type: DNA & cDNA
Ncbi symbol: GABRB1
Origin species: Human
Product name: GABRB1-gamma-aminobutyric acid (GABA) A receptor, beta 1 Gene
Size: 2ug
Accessions: BC022449
Gene id: 2560
Gene description: gamma-aminobutyric acid (GABA) A receptor, beta 1
Synonyms: EIEE45; gamma-aminobutyric acid receptor subunit beta-1; gamma-aminobutyric acid (GABA) A receptor, beta 1; gamma-aminobutyric acid type A receptor beta1 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggacagtacaaaatcgagagagtctggggcttctctctttccctgtgatgattaccatggtctgttgtgcacacagcaccaatgaacccagcaacatgtcatacgtgaaagagacagtggacagattgctcaaaggatatgacattcgcttgcggccggacttcggagggccccccgtcgacgttgggatgcggatcgatgtcgccagcatagacatggtctccgaagtgaatatggattatacactcaccatgtatttccagcagtcttggaaagacaaaaggctttcttattctggaatcccactgaacctcaccctagacaatagggtagctgaccaactctgtgtaccagacacctactttctgaatgacaagaaatcatttgtgcatggggtcacagtgaaaaatcgaatgattcgactgcatcctgatggaacagttctctatggactccgaatcacaaccacagctgcatgtatgatggatcttcgaagatatccactggatgagcagaactgcaccctggagatcgaaagttatggctataccactgatgacattgaattttactggaatggaggagaaggggcagtcactggtgttaataaaatcgaacttcctcaattttcaattgttgactacaagatggtgtctaagaaggtggagttcacaacaggagcgtatccacgactgtcactaagttttcgtctaaagagaaacattggttacttcattttgcaaacctacatgccttctacactgattacaattctgtcctgggtgtctttttggatcaactatgatgcatctgcagccagagtcgcactaggaatcacgacggtgcttacaatgacaaccatcagcacccacctcagggagaccctgccaaagatcccttatgtcaaagcgattgatatttatctgatgggttgctttgtgtttgtgttcctggctctgctggagtatgcctttgtaaattacatcttctttgggaaaggccctcagaaaaagggagctagcaaacaagaccagagtgccaatgagaagaataaactggagatgaataaagtccaggtcgacgcccacggtaacattctcctcagcaccctggaaatccggaatgagacgagtggctcggaagtgctcacgagcgtgagcgaccccaaggccaccatgtactcctatgacagcgccagcatccagtaccgcaagcccctgagcagccgcgaggcctacgggcgcgccctggaccggcacggggtacccagcaaggggcgcaaccgcaggcgtgcctcccagctcaaagtcaagatccccgacttgactgatgtgaattccatagacaagtggtcccgaatgtttttccccatcaccttttctctttttaatgtcgtctattggctttactatgtacactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CAP, adenylate cyclase-associated protein 1 (yeast)
- immunoglobulin heavy constant gamma 1 (G1m marker)
- immunoglobulin heavy constant gamma 1 (G1m marker)
- FAD-dependent oxidoreductase domain containing 1

Buy GABRB1-gamma-aminobutyric acid (GABA) A receptor, beta 1 Gene now

Add to cart