GABRB3-gamma-aminobutyric acid (GABA) A receptor, beta 3 Gene View larger

GABRB3-gamma-aminobutyric acid (GABA) A receptor, beta 3 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GABRB3-gamma-aminobutyric acid (GABA) A receptor, beta 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GABRB3-gamma-aminobutyric acid (GABA) A receptor, beta 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010641
Product type: DNA & cDNA
Ncbi symbol: GABRB3
Origin species: Human
Product name: GABRB3-gamma-aminobutyric acid (GABA) A receptor, beta 3 Gene
Size: 2ug
Accessions: BC010641
Gene id: 2562
Gene description: gamma-aminobutyric acid (GABA) A receptor, beta 3
Synonyms: ECA5; EIEE43; gamma-aminobutyric acid receptor subunit beta-3; GABA-alpha receptor beta-2 subunit; GABAA receptor beta-3 subunit; gamma-aminobutyric acid (GABA) A receptor, beta 3; gamma-aminobutyric acid A receptor beta 3; gamma-aminobutyric acid type A receptor beta3 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggggccttgcgggaggaaggcttttcggcatcttctcggccccggtgctggtggctgtggtgtgctgcgcccagagtgtgaacgatcccgggaacatgtcctttgtgaaggagacggtggacaagctgttgaaaggctacgacattcgcctaagacccgacttcgggggtcccccggtctgcgtggggatgaacatcgacatcgccagcatcgacatggtttccgaagtcaacatggattataccttaaccatgtattttcaacaatattggagagataaaaggctcgcctattctgggatccctctcaacctcacgcttgacaatcgagtggctgaccagctatgggtgcccgacacatatttcttaaatgacaaaaagtcatttgtgcatggagtgacagtgaaaaaccgcatgatccgtcttcaccctgatgggacagtgctgtatgggctcagaatcaccacgacagcagcatgcatgatggacctcaggagataccccctggacgagctgaactgcactctggaaattgaaagctatggctacaccacggatgacattgagttttactggcgaggcggggacaaggctgttaccggagtggaaaggattgagctcccgcagttctccatcgtggagcaccgtctggtctcgaggaatgttgtcttcgccacaggtgcctatcctcgactgtcactgagctttcggttgaagaggaacattggatacttcattcttcagacttatatgccctctatactgataacgattctgtcgtgggtgtccttctggatcaattatgatgcatctgctgctagagttgccctcgggatcacaactgtgctgacaatgacaaccatcaacacccaccttcgggagaccttgcccaaaatcccctatgtcaaagccattgacatgtaccttatgggctgcttcgtctttgtgttcctggcccttctggagtatgcctttgtcaactacattttctttggaagaggccctcaaaggcagaagaagcttgcagaaaagacagccaaggcaaagaatgaccgttcaaagagcgaaagcaaccgggtggatgctcatggaaatattctgttgacatcgctggaagttcacaatgaaatgaatgaggtctcaggcggcattggcgataccaggaattcagcaatatcctttgacaactcaggaatccagtacaggaaacagagcatgcctcgagaagggcatgggcgattcctgggggacagaagcctcccgcacaagaagacccatctacggaggaggtcttcacagctcaaaattaaaatacctgatctaaccgatgtgaatgccatagacagatggtccaggatcgtgtttccattcactttttctcttttcaacttagtttactggctgtactatgttaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gamma-aminobutyric acid (GABA) A receptor, beta 1
- CAP, adenylate cyclase-associated protein 1 (yeast)
- immunoglobulin heavy constant gamma 1 (G1m marker)
- immunoglobulin heavy constant gamma 1 (G1m marker)

Buy GABRB3-gamma-aminobutyric acid (GABA) A receptor, beta 3 Gene now

Add to cart