Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GABRB3-gamma-aminobutyric acid (GABA) A receptor, beta 3 Gene
PTXBC010641
New product
Data sheet of GABRB3-gamma-aminobutyric acid (GABA) A receptor, beta 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GABRB3-gamma-aminobutyric acid (GABA) A receptor, beta 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010641 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GABRB3 |
| Origin species: | Human |
| Product name: | GABRB3-gamma-aminobutyric acid (GABA) A receptor, beta 3 Gene |
| Size: | 2ug |
| Accessions: | BC010641 |
| Gene id: | 2562 |
| Gene description: | gamma-aminobutyric acid (GABA) A receptor, beta 3 |
| Synonyms: | ECA5; EIEE43; gamma-aminobutyric acid receptor subunit beta-3; GABA-alpha receptor beta-2 subunit; GABAA receptor beta-3 subunit; gamma-aminobutyric acid (GABA) A receptor, beta 3; gamma-aminobutyric acid A receptor beta 3; gamma-aminobutyric acid type A receptor beta3 subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggggccttgcgggaggaaggcttttcggcatcttctcggccccggtgctggtggctgtggtgtgctgcgcccagagtgtgaacgatcccgggaacatgtcctttgtgaaggagacggtggacaagctgttgaaaggctacgacattcgcctaagacccgacttcgggggtcccccggtctgcgtggggatgaacatcgacatcgccagcatcgacatggtttccgaagtcaacatggattataccttaaccatgtattttcaacaatattggagagataaaaggctcgcctattctgggatccctctcaacctcacgcttgacaatcgagtggctgaccagctatgggtgcccgacacatatttcttaaatgacaaaaagtcatttgtgcatggagtgacagtgaaaaaccgcatgatccgtcttcaccctgatgggacagtgctgtatgggctcagaatcaccacgacagcagcatgcatgatggacctcaggagataccccctggacgagctgaactgcactctggaaattgaaagctatggctacaccacggatgacattgagttttactggcgaggcggggacaaggctgttaccggagtggaaaggattgagctcccgcagttctccatcgtggagcaccgtctggtctcgaggaatgttgtcttcgccacaggtgcctatcctcgactgtcactgagctttcggttgaagaggaacattggatacttcattcttcagacttatatgccctctatactgataacgattctgtcgtgggtgtccttctggatcaattatgatgcatctgctgctagagttgccctcgggatcacaactgtgctgacaatgacaaccatcaacacccaccttcgggagaccttgcccaaaatcccctatgtcaaagccattgacatgtaccttatgggctgcttcgtctttgtgttcctggcccttctggagtatgcctttgtcaactacattttctttggaagaggccctcaaaggcagaagaagcttgcagaaaagacagccaaggcaaagaatgaccgttcaaagagcgaaagcaaccgggtggatgctcatggaaatattctgttgacatcgctggaagttcacaatgaaatgaatgaggtctcaggcggcattggcgataccaggaattcagcaatatcctttgacaactcaggaatccagtacaggaaacagagcatgcctcgagaagggcatgggcgattcctgggggacagaagcctcccgcacaagaagacccatctacggaggaggtcttcacagctcaaaattaaaatacctgatctaaccgatgtgaatgccatagacagatggtccaggatcgtgtttccattcactttttctcttttcaacttagtttactggctgtactatgttaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gamma-aminobutyric acid (GABA) A receptor, beta 1 - CAP, adenylate cyclase-associated protein 1 (yeast) - immunoglobulin heavy constant gamma 1 (G1m marker) - immunoglobulin heavy constant gamma 1 (G1m marker) |