Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002668 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PECI |
| Origin species: | Human |
| Product name: | PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene |
| Size: | 2ug |
| Accessions: | BC002668 |
| Gene id: | 10455 |
| Gene description: | peroxisomal D3,D2-enoyl-CoA isomerase |
| Synonyms: | PECI; ACBD2; DRS-1; DRS1; HCA88; dJ1013A10.3; enoyl-CoA delta isomerase 2, mitochondrial; D3,D2-enoyl-CoA isomerase; DBI-related protein 1; acyl-Coenzyme A binding domain containing 2; delta(3),delta(2)-enoyl-CoA isomerase; diazepam-binding inhibitor-related protein 1; dodecenoyl-CoA isomerase; hepatocellular carcinoma-associated antigen 88; peroxisomal 3,2-trans-enoyl-CoA isomerase; peroxisomal D3,D2-enoyl-CoA isomerase; renal carcinoma antigen NY-REN-1; testicular secretory protein Li 33; enoyl-CoA delta isomerase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagagccagtcagaaggactttgaaaattcaatgaatcaagtgaaactcttgaaaaaggatccaggaaacgaagtgaagctaaaactctacgcgctatataagcaggccactgaaggaccttgtaacatgcccaaaccaggtgtatttgacttgatcaacaaggccaaatgggacgcatggaatgcccttggcagcctgcccaaggaagctgccaggcagaactatgtggatttggtgtccagtttgagtccttcattggaatcctctagtcaggtggagcctggaacagacaggaaatcaactgggtttgaaactctggtggtgacctccgaagatggcatcacaaagatcatgttcaaccggcccaaaaagaaaaatgccataaacactgagatgtatcatgaaattatgcgtgcacttaaagctgccagcaaggatgactcaatcatcactgttttaacaggaaatggtgactattacagtagtgggaatgatctgactaacttcactgatattccccctggtggagtagaggagaaagctaaaaataatgccgttttactgagggaatttgtgggctgttttatagattttcctaagcctctgattgcagtggtcaatggtccagctgtgggcatctccgtcaccctccttgggctattcgatgccgtgtatgcatctgacagggcaacatttcatacaccatttagtcacctaggccaaagtccggaaggatgctcctcttacacttttccgaagataatgagcccagccaaggcaacagagatgcttatttttggaaagaagttaacagcgggagaggcatgtgctcaaggacttgttactgaagttttccctgatagcacttttcagaaagaagtctggaccaggctgaaggcatttgcaaagcttcccccaaatgccttgagaatttcaaaagaggtaatcaggaaaagagagagagaaaaactacacgctgttaatgctgaagaatgcaatgtccttcagggaagatggctatcagatgaatgcacaaatgctgtggtgaacttcttatccagaaaatcaaaactgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - peroxisomal D3,D2-enoyl-CoA isomerase - mitogen-activated protein kinase 11 - zinc finger, DHHC-type containing 9 - SH3-domain GRB2-like endophilin B1 |