Login to display prices
Login to display prices
PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene View larger

PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene

PTXBC002668

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene

Proteogenix catalog: PTXBC002668
Ncbi symbol: PECI
Product name: PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene
Size: 2ug
Accessions: BC002668
Gene id: 10455
Gene description: peroxisomal D3,D2-enoyl-CoA isomerase
Synonyms: PECI; ACBD2; DRS-1; DRS1; HCA88; dJ1013A10.3; enoyl-CoA delta isomerase 2, mitochondrial; D3,D2-enoyl-CoA isomerase; DBI-related protein 1; acyl-Coenzyme A binding domain containing 2; delta(3),delta(2)-enoyl-CoA isomerase; diazepam-binding inhibitor-related protein 1; dodecenoyl-CoA isomerase; hepatocellular carcinoma-associated antigen 88; peroxisomal 3,2-trans-enoyl-CoA isomerase; peroxisomal D3,D2-enoyl-CoA isomerase; renal carcinoma antigen NY-REN-1; testicular secretory protein Li 33; enoyl-CoA delta isomerase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagagccagtcagaaggactttgaaaattcaatgaatcaagtgaaactcttgaaaaaggatccaggaaacgaagtgaagctaaaactctacgcgctatataagcaggccactgaaggaccttgtaacatgcccaaaccaggtgtatttgacttgatcaacaaggccaaatgggacgcatggaatgcccttggcagcctgcccaaggaagctgccaggcagaactatgtggatttggtgtccagtttgagtccttcattggaatcctctagtcaggtggagcctggaacagacaggaaatcaactgggtttgaaactctggtggtgacctccgaagatggcatcacaaagatcatgttcaaccggcccaaaaagaaaaatgccataaacactgagatgtatcatgaaattatgcgtgcacttaaagctgccagcaaggatgactcaatcatcactgttttaacaggaaatggtgactattacagtagtgggaatgatctgactaacttcactgatattccccctggtggagtagaggagaaagctaaaaataatgccgttttactgagggaatttgtgggctgttttatagattttcctaagcctctgattgcagtggtcaatggtccagctgtgggcatctccgtcaccctccttgggctattcgatgccgtgtatgcatctgacagggcaacatttcatacaccatttagtcacctaggccaaagtccggaaggatgctcctcttacacttttccgaagataatgagcccagccaaggcaacagagatgcttatttttggaaagaagttaacagcgggagaggcatgtgctcaaggacttgttactgaagttttccctgatagcacttttcagaaagaagtctggaccaggctgaaggcatttgcaaagcttcccccaaatgccttgagaatttcaaaagaggtaatcaggaaaagagagagagaaaaactacacgctgttaatgctgaagaatgcaatgtccttcagggaagatggctatcagatgaatgcacaaatgctgtggtgaacttcttatccagaaaatcaaaactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: