PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene View larger

PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034702
Product type: DNA & cDNA
Ncbi symbol: PECI
Origin species: Human
Product name: PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene
Size: 2ug
Accessions: BC034702
Gene id: 10455
Gene description: peroxisomal D3,D2-enoyl-CoA isomerase
Synonyms: PECI; ACBD2; DRS-1; DRS1; HCA88; dJ1013A10.3; enoyl-CoA delta isomerase 2, mitochondrial; D3,D2-enoyl-CoA isomerase; DBI-related protein 1; acyl-Coenzyme A binding domain containing 2; delta(3),delta(2)-enoyl-CoA isomerase; diazepam-binding inhibitor-related protein 1; dodecenoyl-CoA isomerase; hepatocellular carcinoma-associated antigen 88; peroxisomal 3,2-trans-enoyl-CoA isomerase; peroxisomal D3,D2-enoyl-CoA isomerase; renal carcinoma antigen NY-REN-1; testicular secretory protein Li 33; enoyl-CoA delta isomerase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatagaacagcaatgagagccagtcagaaggactttgaaaattcaatgaatcaagtgaaactcttgaaaaaggatccaggaaacgaagtgaagctaaaactctacgcgctatataagcaggccactgaaggaccttgtaacatgcccaaaccaggtgtatttgacttgatcaacaaggccaaatgggacgcatggaatgcccttggcagcctgcccaaggaagctgccaggcagaactatgtggatttggtgtccagtttgagtccttcattggaatcctctagtcaggtggagcctggaacagacaggaaatcaactgggtttgaaactctggtggtgacctccgaagatggcatcacaaagatcatgttcaaccggcccaaaaagaaaaatgccataaacactgagatgtatcatgaaattatgcgtgcacttaaagctgccagcaaggatgactcaatcatcactgttttaacaggaaatggtgactattacagtagtgggaatgatctgactaacttcactgatattccccctggtggagtagaggagaaagctaaaaataatgccgttttactgagggaatttgtgggctgttttatagattttcctaagcctctgattgcagtggtcaatggtccagctgtgggcatctccgtcaccctccttgggctattcgatgccgtgtatgcatctgacagggcaacatttcatacaccatttagtcacctaggccaaagtccggaaggatgctcctcttacacttttccgaagataatgagcccagccaaggcaacagagatgcttatttttggaaagaagttaacagcgggagaggcatgtgctcaaggacttgttactgaagttttccctgatagcacttttcagaaagaagtctggaccaggctgaaggcatttgcaaagcttcccccaaatgccttgagaatttcaaaagaggtaatcaggaaaagagagagagaaaaactacacgctgttaatgctgaagaatgcaatgtccttcagggaagatggctatcagatgaatgcacaaatgctgtggtgaacttcttatccagaaaatcaaaactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitogen-activated protein kinase 11
- zinc finger, DHHC-type containing 9
- SH3-domain GRB2-like endophilin B1
- zinc finger, DHHC-type containing 2

Buy PECI-peroxisomal D3,D2-enoyl-CoA isomerase Gene now

Add to cart