SH3GLB1-SH3-domain GRB2-like endophilin B1 Gene View larger

SH3GLB1-SH3-domain GRB2-like endophilin B1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SH3GLB1-SH3-domain GRB2-like endophilin B1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SH3GLB1-SH3-domain GRB2-like endophilin B1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007455
Product type: DNA & cDNA
Ncbi symbol: SH3GLB1
Origin species: Human
Product name: SH3GLB1-SH3-domain GRB2-like endophilin B1 Gene
Size: 2ug
Accessions: BC007455
Gene id: 51100
Gene description: SH3-domain GRB2-like endophilin B1
Synonyms: SH3-containing protein SH3GLB1; Bif-1; CGI-61; PPP1R70; dJ612B15.2; endophilin-B1; Bax-interacting factor 1; SH3 domain-containing GRB2-like protein B1; SH3-domain GRB2 like endophilin B1; protein phosphatase 1, regulatory subunit 70; testicular tissue protein Li 172; SH3 domain containing GRB2 like endophilin B1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatatcatggacttcaacgtgaagaagctggcggccgacgcaggcaccttcctcagtcgcgccgtgcagttcacagaagaaaagcttggccaggctgagaagacagaattggatgctcacttagagaacctccttagcaaagctgaatgtaccaaaatatggacagaaaaaataatgaaacaaactgaagtgttattgcagccaaatccaaatgccaggatagaagaatttgtttatgagaaactggatagaaaagctccaagtcgtataaacaacccagaacttttgggacaatatatgattgatgcagggactgagtttggcccaggaacagcttatggtaatgcccttattaaatgtggagaaacccaaaaaagaattggaacagcagacagagaactgattcaaacgtcagccttaaattttcttactcctttaagaaactttatagaaggagattacaaaacaattgctaaagaaaggaaactattgcaaaataagagactggatttggatgctgcaaaaacgagactaaaaaaggcaaaagctgcagaaactagaaattcatctgaacaggaattaagaataactcaaagtgaatttgatcgtcaagcagagattaccagacttctgctagagggaatcagcagtacacatgcccatcaccttcgctgtctgaatgactttgtagaagcccagatgacttactatgcacagtgttaccagtatatgttggacctccagaaacaactgggaagttttccatccaattatcttagtaacaacaatcagacttctgtgacacctgtaccatcagttttaccaaatgcgattggttcttctgccatggcttcaacaagtggcctagtaatcacctctccttccaacctcagtgaccttaaggagtgtagtggcagcagaaaggccagggttctctatgattatgatgcagcaaacagtactgaattatcacttctggcagatgaggtgatcactgtgttcagtgttgttggaatggattcagactggctaatgggggaaaggggaaaccagaagggcaaggtgccaattacctacttagaactgctcaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, DHHC-type containing 2
- chromosome 2 open reading frame 18
- chromosome 3 open reading frame 19
- ciliary neurotrophic factor receptor

Buy SH3GLB1-SH3-domain GRB2-like endophilin B1 Gene now

Add to cart