C2orf18-chromosome 2 open reading frame 18 Gene View larger

C2orf18-chromosome 2 open reading frame 18 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf18-chromosome 2 open reading frame 18 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf18-chromosome 2 open reading frame 18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028081
Product type: DNA & cDNA
Ncbi symbol: C2orf18
Origin species: Human
Product name: C2orf18-chromosome 2 open reading frame 18 Gene
Size: 2ug
Accessions: BC028081
Gene id: 54978
Gene description: chromosome 2 open reading frame 18
Synonyms: transmembrane protein C2orf18; C2orf18; ANT2BP; TANGO9; solute carrier family 35 member F6; ANT2-binding protein; transport and golgi organization 9 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctggaccaagtaccagctgttcctggccgggctcatgcttgttaccggctccatcaacacgctctcggcaaaatgggcggacaatttcatggccgagggctgtggagggagcaaggagcacagcttccagcatcccttcctccaggcagtgggcatgttcctgggagaattctcctgcctggctgccttctacctcctccgatgcagagctgcagggcaatcagactccagcgtagacccccagcagcccttcaaccctcttcttttcctgcccccagcgctctgtgacatgacagggaccagcctcatgtatgtggctctgaacatgaccagtgcctccagcttccagatgctgcggggtgcagtgatcatattcactggcctgttctcggtggccttcctgggccggaggctggtgctgagccagtggctgggcatcctagccaccatcgcggggctggtggtcgtgggcctggctgacctcctgagcaagcacgacagtcagcacaagctcagcgaagtgatcacaggggacctgttgatcatcatggcccagatcatcgttgccatccagatggtgctagaggagaagttcgtctacaaacacaatgtgcacccactgcgggcagttggcactgagggcctctttggctttgtgatcctctccctgctgctggtgcccatgtactacatccccgccggctccttcagcggaaaccctcgtgggacactggaggatgcattggacgccttctgccaggtgggccagcagccgctcattgccgtggcactgctgggcaacatcagcagcattgccttcttcaacttcgcaggcatcagcgtcaccaaggaactgagcgccaccacccgcatggtgttggacagcttgcgcaccgttgtcatctgggcactgagcctggcactgggctgggaggccttccatgcactgcagatccttggcttcctcatactccttataggcactgccctctacaatgggctacaccgtccgctgctgggccgcctgtccaggggccggcccctggcagaggagagcgagcaggagagactgctgggtggcacccgcactcccatcaatgatgccagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 3 open reading frame 19
- ciliary neurotrophic factor receptor
- chromosome 1 open reading frame 27
- Ly1 antibody reactive homolog (mouse)

Buy C2orf18-chromosome 2 open reading frame 18 Gene now

Add to cart