ZDHHC9-zinc finger, DHHC-type containing 9 Gene View larger

ZDHHC9-zinc finger, DHHC-type containing 9 Gene

PTXBC000035

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZDHHC9-zinc finger, DHHC-type containing 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZDHHC9-zinc finger, DHHC-type containing 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000035
Product type: DNA & cDNA
Ncbi symbol: ZDHHC9
Origin species: Human
Product name: ZDHHC9-zinc finger, DHHC-type containing 9 Gene
Size: 2ug
Accessions: BC000035
Gene id: 51114
Gene description: zinc finger, DHHC-type containing 9
Synonyms: palmitoyltransferase ZDHHC9; CGI89; CXorf11; MMSA1; MRXSZ; ZDHHC10; ZNF379; ZNF380; Asp-His-His-Cys domain containing protein 9; antigen MMSA-1; zinc finger protein 379; zinc finger protein 380; zinc finger, DHHC domain containing 10; zinc finger DHHC-type containing 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgtgatggtggtgagaaagaaggtgacacggaaatgggagaaactcccaggcaggaacaccttttgctgtgatggccgcgtcatgatggcccggcaaaagggcattttctacctgacccttttcctcatcctggggacatgtacactcttcttcgcctttgagtgccgctacctggctgttcagctgtctcctgccatccctgtatttgctgccatgctcttccttttctccatggctacactgttgaggaccagcttcagtgaccctggagtgattcctcgggcgctaccagatgaagcagctttcatagaaatggagatagaagctaccaatggtgcggtgccccagggccagcgaccaccgcctcgtatcaagaatttccagataaacaaccagattgtgaaactgaaatactgttacacatgcaagatcttccggcctccccgggcctcccattgcagcatctgtgacaactgtgtggagcgcttcgaccatcactgcccctgggtggggaattgtgttggaaagaggaactaccgctacttctacctcttcatcctttctctctccctcctcacaatctatgtcttcgccttcaacatcgtctatgtggccctcaaatctttgaaaattggcttcttggagacattgaaagaaactcctggaactgttctagaagtcctcatttgcttctttacactctggtccgtcgtgggactgactggatttcatactttcctcgtggctctcaaccagacaaccaatgaagacatcaaaggatcatggacagggaagaatcgcgtccagaatccctacagccatggcaatattgtgaagaactgctgtgaagtgctgtgtggccccttgccccccagtgtgctggatcgaaggggtattttgccactggaggaaagtggaagtcgacctcccagtactcaagagaccagtagcagcctcttgccacagagcccagcccccacagaacacctgaactcaaatgagatgccggaggacagcagcactcccgaagagatgccacctccagagcccccagagccaccacaggaggcagctgaagctgagaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SH3-domain GRB2-like endophilin B1
- zinc finger, DHHC-type containing 2
- chromosome 2 open reading frame 18
- chromosome 3 open reading frame 19

Buy ZDHHC9-zinc finger, DHHC-type containing 9 Gene now

Add to cart