MAPK11-mitogen-activated protein kinase 11 Gene View larger

MAPK11-mitogen-activated protein kinase 11 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAPK11-mitogen-activated protein kinase 11 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAPK11-mitogen-activated protein kinase 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027933
Product type: DNA & cDNA
Ncbi symbol: MAPK11
Origin species: Human
Product name: MAPK11-mitogen-activated protein kinase 11 Gene
Size: 2ug
Accessions: BC027933
Gene id: 5600
Gene description: mitogen-activated protein kinase 11
Synonyms: P38B; P38BETA2; PRKM11; SAPK2; SAPK2B; p38-2; p38Beta; mitogen-activated protein kinase 11; MAP kinase 11; MAP kinase p38 beta; mitogen-activated protein kinase p38 beta; mitogen-activated protein kinase p38-2; stress-activated protein kinase-2; stress-activated protein kinase-2b
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgggccctcgcgccggcttctaccggcaggagctgaacaagaccgtgtgggaggtgccgcagcggctgcaggggctgcgcccggtgggctccggcgcctacggctccgtctgttcggcctacgacgcccggctgcgccagaaggtggcggtgaagaagctgtcgcgccccttccagtcgctgatccacgcgcgcagaacgtaccgggagctgcggctgctcaagcacctgaagcacgagaacgtcatcgggcttctggacgtcttcacgccggccacgtccatcgaggacttcagcgaagtgtacttggtgaccaccctgatgggcgccgacctgaacaacatcgtcaagtgccaggcgctgagcgacgagcacgttcaattcctggtttaccagctgctgcgcgggctgaagtacatccactcggccgggatcatccaccgggacctgaagcccagcaacgtggctgtgaacgaggactgtgagctcaggatcctggatttcgggctggcgcgccaggcggacgaggagatgaccggctatgtggccacgcgctggtaccgggcacctgagatcatgctcaactggatgcattacaaccaaacagtggatatctggtccgtgggctgcatcatggctgagctgctccagggcaaggccctcttcccgggaagcgactacattgaccagctgaagcgcatcatggaagtggtgggcacacccagccctgaggttctggcaaaaatctcctcagaacacgcccggacatatatccagtccctgccccccatgccccagaaggacctgagcagcatcttccgtggagccaaccccctggccatagacctccttggaaggatgctggtgctggacagtgaccagagggtcagtgcagctgaggcactggcccacgcctacttcagccagtaccacgaccccgaggatgagccagaggccgagccatatgatgagagcgttgaggccaaggagcgcacgctggaggagtggaaggagctcacttaccaggaagtcctcagcttcaagcccccagagccaccgaagccacctggcagcctggagattgagcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, DHHC-type containing 9
- SH3-domain GRB2-like endophilin B1
- zinc finger, DHHC-type containing 2
- chromosome 2 open reading frame 18

Buy MAPK11-mitogen-activated protein kinase 11 Gene now

Add to cart