Cart 5 Product Products 567,00 € (empty)
-
1 x GPX7-gluta...113,40 € -
1 x TMEM51-tra...113,40 € -
1 x PCDHGC3-pr...113,40 € -
1 x TMEM217-tr...113,40 € -
1 x MTUS1-mito...113,40 €
No products
To be determined Shipping
567,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 567,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 567,00 €
Data sheet of CYTIP-cytohesin 1 interacting protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYTIP-cytohesin 1 interacting protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036449 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYTIP |
| Origin species: | Human |
| Product name: | CYTIP-cytohesin 1 interacting protein Gene |
| Size: | 2ug |
| Accessions: | BC036449 |
| Gene id: | 9595 |
| Gene description: | cytohesin 1 interacting protein |
| Synonyms: | B3-1; CASP; CYBR; CYTHIP; PSCDBP; cytohesin-interacting protein; cbp HE; cytohesin binder and regulator; cytohesin binding protein HE; cytohesin-associated scaffolding protein; pleckstrin homology Sec7 and coiled-coil domains-binding protein; cytohesin 1 interacting protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctttacaaaggctcctgcaacacagcagcaatggcaatttggcggacttctgcgctgggccagcgtatagctcttactccacactcaccggcagccttacgatggacgataatagaaggattcaaatgctagcagacacggtggctactctgcctcggggacgaaagcagcttgctttgaccagatcaagttctttaagtgacttttcctggtctcaaagaaagcttgttactgtggagaagcaggataatgaaacatttggatttgaaattcagtcttacaggccccagaatcagaatgcctgctcctcggaaatgttcactttgatatgcaaaatacaggaggacagcccagctcactgtgctggcctgcaagctggtgatgtccttgcaaatatcaatggtgtgagcacagaaggttttacctacaaacaagtcgttgacctgatcagatcgtccggaaacctgctaacgatagagactcttaatggaacaatgattctgaaaagaacggagcttgaagcaaagctgcaggttttaaagcaaactttgaaacaaaaatgggtggagtacagatctctgcagttacaggaacatcgtctgcttcatggtgatgcagctaattgccccagtttggaaaacatggacttggatgaattgtctttgtttggacccctgcctgggccaggcccagcccttgtggaccggaatcgattatccagtgagagcagctgtaagagctggctgagctccatgacgatggacagtgaagatggctaccagacgtgtgtgtctgaggactccagcaggggtgccttcagtcggcagacgagtacagatgatgagtgctttatccccaaggagggggatgattttctgaggaggtcatcttcaaggaggaaccggagcatcagtaacaccagcagcggatccatgtctcccttgtgggagggcaacttatcaagcatgtttgggaccctgccccggaagagcagaaagggaagtgtccgaaagcaactcttgaaatttatccctggccttcatcgtgctgtggaagaggaagaaagtcgcttttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - arrestin 3, retinal (X-arrestin) - N-acetylneuraminic acid synthase - ubiquitin specific peptidase 46 - ataxia, cerebellar, Cayman type |