Login to display prices
Login to display prices
CYTIP-cytohesin 1 interacting protein Gene View larger

CYTIP-cytohesin 1 interacting protein Gene

PTXBC036449

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYTIP-cytohesin 1 interacting protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CYTIP-cytohesin 1 interacting protein Gene

Proteogenix catalog: PTXBC036449
Ncbi symbol: CYTIP
Product name: CYTIP-cytohesin 1 interacting protein Gene
Size: 2ug
Accessions: BC036449
Gene id: 9595
Gene description: cytohesin 1 interacting protein
Synonyms: B3-1; CASP; CYBR; CYTHIP; PSCDBP; cytohesin-interacting protein; cbp HE; cytohesin binder and regulator; cytohesin binding protein HE; cytohesin-associated scaffolding protein; pleckstrin homology Sec7 and coiled-coil domains-binding protein; cytohesin 1 interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctttacaaaggctcctgcaacacagcagcaatggcaatttggcggacttctgcgctgggccagcgtatagctcttactccacactcaccggcagccttacgatggacgataatagaaggattcaaatgctagcagacacggtggctactctgcctcggggacgaaagcagcttgctttgaccagatcaagttctttaagtgacttttcctggtctcaaagaaagcttgttactgtggagaagcaggataatgaaacatttggatttgaaattcagtcttacaggccccagaatcagaatgcctgctcctcggaaatgttcactttgatatgcaaaatacaggaggacagcccagctcactgtgctggcctgcaagctggtgatgtccttgcaaatatcaatggtgtgagcacagaaggttttacctacaaacaagtcgttgacctgatcagatcgtccggaaacctgctaacgatagagactcttaatggaacaatgattctgaaaagaacggagcttgaagcaaagctgcaggttttaaagcaaactttgaaacaaaaatgggtggagtacagatctctgcagttacaggaacatcgtctgcttcatggtgatgcagctaattgccccagtttggaaaacatggacttggatgaattgtctttgtttggacccctgcctgggccaggcccagcccttgtggaccggaatcgattatccagtgagagcagctgtaagagctggctgagctccatgacgatggacagtgaagatggctaccagacgtgtgtgtctgaggactccagcaggggtgccttcagtcggcagacgagtacagatgatgagtgctttatccccaaggagggggatgattttctgaggaggtcatcttcaaggaggaaccggagcatcagtaacaccagcagcggatccatgtctcccttgtgggagggcaacttatcaagcatgtttgggaccctgccccggaagagcagaaagggaagtgtccgaaagcaactcttgaaatttatccctggccttcatcgtgctgtggaagaggaagaaagtcgcttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: