CYTIP-cytohesin 1 interacting protein Gene View larger

CYTIP-cytohesin 1 interacting protein Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYTIP-cytohesin 1 interacting protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CYTIP-cytohesin 1 interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036449
Product type: DNA & cDNA
Ncbi symbol: CYTIP
Origin species: Human
Product name: CYTIP-cytohesin 1 interacting protein Gene
Size: 2ug
Accessions: BC036449
Gene id: 9595
Gene description: cytohesin 1 interacting protein
Synonyms: B3-1; CASP; CYBR; CYTHIP; PSCDBP; cytohesin-interacting protein; cbp HE; cytohesin binder and regulator; cytohesin binding protein HE; cytohesin-associated scaffolding protein; pleckstrin homology Sec7 and coiled-coil domains-binding protein; cytohesin 1 interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctttacaaaggctcctgcaacacagcagcaatggcaatttggcggacttctgcgctgggccagcgtatagctcttactccacactcaccggcagccttacgatggacgataatagaaggattcaaatgctagcagacacggtggctactctgcctcggggacgaaagcagcttgctttgaccagatcaagttctttaagtgacttttcctggtctcaaagaaagcttgttactgtggagaagcaggataatgaaacatttggatttgaaattcagtcttacaggccccagaatcagaatgcctgctcctcggaaatgttcactttgatatgcaaaatacaggaggacagcccagctcactgtgctggcctgcaagctggtgatgtccttgcaaatatcaatggtgtgagcacagaaggttttacctacaaacaagtcgttgacctgatcagatcgtccggaaacctgctaacgatagagactcttaatggaacaatgattctgaaaagaacggagcttgaagcaaagctgcaggttttaaagcaaactttgaaacaaaaatgggtggagtacagatctctgcagttacaggaacatcgtctgcttcatggtgatgcagctaattgccccagtttggaaaacatggacttggatgaattgtctttgtttggacccctgcctgggccaggcccagcccttgtggaccggaatcgattatccagtgagagcagctgtaagagctggctgagctccatgacgatggacagtgaagatggctaccagacgtgtgtgtctgaggactccagcaggggtgccttcagtcggcagacgagtacagatgatgagtgctttatccccaaggagggggatgattttctgaggaggtcatcttcaaggaggaaccggagcatcagtaacaccagcagcggatccatgtctcccttgtgggagggcaacttatcaagcatgtttgggaccctgccccggaagagcagaaagggaagtgtccgaaagcaactcttgaaatttatccctggccttcatcgtgctgtggaagaggaagaaagtcgcttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - arrestin 3, retinal (X-arrestin)
- N-acetylneuraminic acid synthase
- ubiquitin specific peptidase 46
- ataxia, cerebellar, Cayman type

Buy CYTIP-cytohesin 1 interacting protein Gene now

Add to cart