Login to display prices
Login to display prices
ATCAY-ataxia, cerebellar, Cayman type Gene View larger

ATCAY-ataxia, cerebellar, Cayman type Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATCAY-ataxia, cerebellar, Cayman type Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATCAY-ataxia, cerebellar, Cayman type Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026217
Product type: DNA & cDNA
Ncbi symbol: ATCAY
Origin species: Human
Product name: ATCAY-ataxia, cerebellar, Cayman type Gene
Size: 2ug
Accessions: BC026217
Gene id: 85300
Gene description: ataxia, cerebellar, Cayman type
Synonyms: ATCAY, caytaxin; BNIP-H; CLAC; caytaxin; BNIP-2-homolgy; BNIP-2-homology; ataxia cayman type protein; ataxia cerebellar Cayman type
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaccaccgaagccacgctccggatggaaaacgtggacgtgaaggaggaatggcaggacgaagatcttcccaggccactcccagaagagacgggggtggaactgcttggcagcccggtggaagacacatcctctcctcccaacacgctaaatttcaacggagcgcatcgtaagaggaagacgctggtggccccagagatcaacatttctctggatcagagtgaggggtccctgctgtccgatgacttcttggatacccctgatgacctggatattaacgtggatgacatcgagacccccgatgagaccgactcgctggagttcctggggaatggcaacgaactggagtgggaagacgacacccccgtggccaccgccaagaacatgcccggggacagcgcggatctatttggggacggcacgacggaggacggcagcgccgccaacgggcgcctgtggcggacagtgatcatcggggagcaagagcaccgtatagacctgcacatgatccggccttacatgaaagtggtcacccacggagggtactacggcgaaggcctcaacgccatcatcgtcttcgcagcctgcttccttccagacagcagcctccccgactaccactacatcatggagaacctcttcctgtacgtcatcagcagcttagagctcctggtggctgaggactacatgatcgtgtacctgaacggtgccacgccccggcggaggatgcctggaatcggctggctgaagaagtgctaccagatgatcgaccggaggttgcggaaaaacctgaagtccttgatcatcgtccacccctcgtggttcattcggactgtgctggccatctctcgccctttcatcagcgtcaagttcatcaacaagatccagtacgtgcacagcttggaagacctggagcaactcatccctatggaacacgtccagatcccagactgcgtcctgcaatacgaagaggaaagactgaaggccaggagggagagcgcgaggccccagccggagtttgtgctgcccaggtctgaagagaagccagaggtggcaccagtggaaaacaggtctgctctggtctcagaagatcaggaaacaagcatgtcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine (C-C motif) receptor 6
- ubiquitin specific peptidase 21
- G protein-coupled receptor 182
- round spermatid basic protein 1