GPR182-G protein-coupled receptor 182 Gene View larger

GPR182-G protein-coupled receptor 182 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR182-G protein-coupled receptor 182 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPR182-G protein-coupled receptor 182 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034761
Product type: DNA & cDNA
Ncbi symbol: GPR182
Origin species: Human
Product name: GPR182-G protein-coupled receptor 182 Gene
Size: 2ug
Accessions: BC034761
Gene id: 11318
Gene description: G protein-coupled receptor 182
Synonyms: 7TMR; ADMR; AM-R; AMR; G10D; gamrh; hrhAMR; G-protein coupled receptor 182; adrenomedullin receptor; G protein-coupled receptor 182
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagtgaaacccagctgggggcctggcccctcggagggggtcaccgcagtgcctaccagtgaccttggagagatccacaactggaccgagctgcttgacctcttcaaccacactttgtctgagtgccacgtggagctcagccagagcaccaagcgcgtggtcctctttgccctctacctggccatgtttgtggttgggctggtggagaacctcctggtgatatgcgtcaactggcgcggctcaggccgggcagggctgatgaacctctacatcctcaacatggccatcgcggacctgggcattgtcctgtctctgcccgtgtggatgctggaggtcacgctggactacacctggctctggggcagcttctcctgccgcttcactcactacttctactttgtcaacatgtatagcagcatcttcttcctggtgtgcctcagtgtcgaccgctatgtcaccctcaccagcgcctccccctcctggcagcgttaccagcaccgagtgcggcgggccatgtgtgcaggcatctgggtcctctcggccatcatcccgctgcctgaggtggtccacatccagctggtggagggccctgagcccatgtgcctcttcatggcaccttttgaaacgtacagcacctgggccctggcggtggccctgtccaccaccatcctgggcttcctgctgcccttccctctcatcacagtcttcaatgtgctgacagcctgccggctgcggcagccaggacaacccaagagccggcgccactgcctgctgctgtgcgcctacgtggccgtctttgtcatgtgctggctgccctatcatgtgaccctgctgctgctcacactgcatgggacccacatctccctccactgccacctggtccacctgctctacttcttctatgatgtcattgactgcttctccatgctgcactgtgtcatcaaccccatcctttacaactttctcagcccacacttccggggccggctcctgaatgctgtagtccattaccttcctaaggaccagaccaaggcgggcacatgcgcctcctcttcctcctgttccacccagcattccatcatcatcaccaagggtgatagccagcctgctgcagcagccccccaccctgagccaagcctgagctttcaggcacaccatttgcttccaaatacttcccccatctctcccactcagcctcttacacccagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - round spermatid basic protein 1
- carboxypeptidase A2 (pancreatic)
- carboxypeptidase A1 (pancreatic)
- GDP-mannose pyrophosphorylase A

Buy GPR182-G protein-coupled receptor 182 Gene now

Add to cart