Cart 46 Product Products 20 775,00 € (empty)
No products
To be determined Shipping
20 775,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 46 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 20 775,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 20 775,00 €
Data sheet of GPR182-G protein-coupled receptor 182 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR182-G protein-coupled receptor 182 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034761 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR182 |
| Origin species: | Human |
| Product name: | GPR182-G protein-coupled receptor 182 Gene |
| Size: | 2ug |
| Accessions: | BC034761 |
| Gene id: | 11318 |
| Gene description: | G protein-coupled receptor 182 |
| Synonyms: | 7TMR; ADMR; AM-R; AMR; G10D; gamrh; hrhAMR; G-protein coupled receptor 182; adrenomedullin receptor; G protein-coupled receptor 182 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcagtgaaacccagctgggggcctggcccctcggagggggtcaccgcagtgcctaccagtgaccttggagagatccacaactggaccgagctgcttgacctcttcaaccacactttgtctgagtgccacgtggagctcagccagagcaccaagcgcgtggtcctctttgccctctacctggccatgtttgtggttgggctggtggagaacctcctggtgatatgcgtcaactggcgcggctcaggccgggcagggctgatgaacctctacatcctcaacatggccatcgcggacctgggcattgtcctgtctctgcccgtgtggatgctggaggtcacgctggactacacctggctctggggcagcttctcctgccgcttcactcactacttctactttgtcaacatgtatagcagcatcttcttcctggtgtgcctcagtgtcgaccgctatgtcaccctcaccagcgcctccccctcctggcagcgttaccagcaccgagtgcggcgggccatgtgtgcaggcatctgggtcctctcggccatcatcccgctgcctgaggtggtccacatccagctggtggagggccctgagcccatgtgcctcttcatggcaccttttgaaacgtacagcacctgggccctggcggtggccctgtccaccaccatcctgggcttcctgctgcccttccctctcatcacagtcttcaatgtgctgacagcctgccggctgcggcagccaggacaacccaagagccggcgccactgcctgctgctgtgcgcctacgtggccgtctttgtcatgtgctggctgccctatcatgtgaccctgctgctgctcacactgcatgggacccacatctccctccactgccacctggtccacctgctctacttcttctatgatgtcattgactgcttctccatgctgcactgtgtcatcaaccccatcctttacaactttctcagcccacacttccggggccggctcctgaatgctgtagtccattaccttcctaaggaccagaccaaggcgggcacatgcgcctcctcttcctcctgttccacccagcattccatcatcatcaccaagggtgatagccagcctgctgcagcagccccccaccctgagccaagcctgagctttcaggcacaccatttgcttccaaatacttcccccatctctcccactcagcctcttacacccagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - round spermatid basic protein 1 - carboxypeptidase A2 (pancreatic) - carboxypeptidase A1 (pancreatic) - GDP-mannose pyrophosphorylase A |