NANS-N-acetylneuraminic acid synthase Gene View larger

NANS-N-acetylneuraminic acid synthase Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NANS-N-acetylneuraminic acid synthase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NANS-N-acetylneuraminic acid synthase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019315
Product type: DNA & cDNA
Ncbi symbol: NANS
Origin species: Human
Product name: NANS-N-acetylneuraminic acid synthase Gene
Size: 2ug
Accessions: BC019315
Gene id: 54187
Gene description: N-acetylneuraminic acid synthase
Synonyms: HEL-S-100; SAS; SEMDCG; SEMDG; sialic acid synthase; N-acetylneuraminate-9-phosphate synthase; N-acetylneuraminic acid phosphate synthase; N-acetylneuraminic acid synthase; epididymis secretory protein Li 100; sialic acid phosphate synthase; N-acetylneuraminate synthase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgctggagctggagctgtgtcccgggcgctgggtgggcgggcaacacccgtgcttcatcattgccgagatcggccagaaccaccagggcgacctggacgtagccaagcgcatgatccgcatggccaaggagtgtggggctgattgtgccaagttccagaagagtgagctagaattcaagtttaatcggaaagccttggacaggccatacacctcgaagcattcctgggggaagacgtacggggagcacaaacgacatctggagttcagccatgaccagtacagggagctgcagaggtacgccgaggaggttgggatcttcttcactgcctctggcatggatgagatggcagttgaattcctgcatgaactgaatgttccatttttcaaagttggatctggagacactaataattttccttatctggaaaagacagccaaaaaaggtcgcccaatggtgatctccagtgggatgcagtcaatggacaccatgaagcaagtttatcagatcgtgaagcccctcaaccccaacttctgcttcttgcagtgtaccagcgcatacccgctccagcctgaggacgtcaacctgcgggtcatctcggaatatcagaagctctttcctgacattcccatagggtattctgggcatgaaacaggcatagcgatatctgtggccgcagtggctctgggggccaaggtgttggaacgtcacataactttggacaagacctggaaggggagtgaccactcggcctcgctggagcctggagaactggccgagctggtgcggtcagtgcgtcttgtggagcgtgccctgggctccccaaccaagcagctgctgccctgtgagatggcctgcaatgagaagctgggcaagtctgtggtggccaaagtgaaaattccggaaggcaccattctaacaatggacatgctcaccgtgaaggtgggtgagcccaaaggctatcctcctgaagacatctttaatctagtgggcaagaaggtcctggtcactgttgaagaggatgacaccatcatggaagaattggtagataatcatggcaaaaaaatcaagtcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin specific peptidase 46
- ataxia, cerebellar, Cayman type
- chemokine (C-C motif) receptor 6
- ubiquitin specific peptidase 21

Buy NANS-N-acetylneuraminic acid synthase Gene now

Add to cart