Login to display prices
Login to display prices
NANS-N-acetylneuraminic acid synthase Gene View larger

NANS-N-acetylneuraminic acid synthase Gene

PTXBC019315

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NANS-N-acetylneuraminic acid synthase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NANS-N-acetylneuraminic acid synthase Gene

Proteogenix catalog: PTXBC019315
Ncbi symbol: NANS
Product name: NANS-N-acetylneuraminic acid synthase Gene
Size: 2ug
Accessions: BC019315
Gene id: 54187
Gene description: N-acetylneuraminic acid synthase
Synonyms: HEL-S-100; SAS; SEMDCG; SEMDG; sialic acid synthase; N-acetylneuraminate-9-phosphate synthase; N-acetylneuraminic acid phosphate synthase; N-acetylneuraminic acid synthase; epididymis secretory protein Li 100; sialic acid phosphate synthase; N-acetylneuraminate synthase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgctggagctggagctgtgtcccgggcgctgggtgggcgggcaacacccgtgcttcatcattgccgagatcggccagaaccaccagggcgacctggacgtagccaagcgcatgatccgcatggccaaggagtgtggggctgattgtgccaagttccagaagagtgagctagaattcaagtttaatcggaaagccttggacaggccatacacctcgaagcattcctgggggaagacgtacggggagcacaaacgacatctggagttcagccatgaccagtacagggagctgcagaggtacgccgaggaggttgggatcttcttcactgcctctggcatggatgagatggcagttgaattcctgcatgaactgaatgttccatttttcaaagttggatctggagacactaataattttccttatctggaaaagacagccaaaaaaggtcgcccaatggtgatctccagtgggatgcagtcaatggacaccatgaagcaagtttatcagatcgtgaagcccctcaaccccaacttctgcttcttgcagtgtaccagcgcatacccgctccagcctgaggacgtcaacctgcgggtcatctcggaatatcagaagctctttcctgacattcccatagggtattctgggcatgaaacaggcatagcgatatctgtggccgcagtggctctgggggccaaggtgttggaacgtcacataactttggacaagacctggaaggggagtgaccactcggcctcgctggagcctggagaactggccgagctggtgcggtcagtgcgtcttgtggagcgtgccctgggctccccaaccaagcagctgctgccctgtgagatggcctgcaatgagaagctgggcaagtctgtggtggccaaagtgaaaattccggaaggcaccattctaacaatggacatgctcaccgtgaaggtgggtgagcccaaaggctatcctcctgaagacatctttaatctagtgggcaagaaggtcctggtcactgttgaagaggatgacaccatcatggaagaattggtagataatcatggcaaaaaaatcaagtcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: