USP46-ubiquitin specific peptidase 46 Gene View larger

USP46-ubiquitin specific peptidase 46 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of USP46-ubiquitin specific peptidase 46 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about USP46-ubiquitin specific peptidase 46 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037574
Product type: DNA & cDNA
Ncbi symbol: USP46
Origin species: Human
Product name: USP46-ubiquitin specific peptidase 46 Gene
Size: 2ug
Accessions: BC037574
Gene id: 64854
Gene description: ubiquitin specific peptidase 46
Synonyms: ubiquitin carboxyl-terminal hydrolase 46; deubiquitinating enzyme 46; ubiquitin thioesterase 46; ubiquitin thiolesterase 46; ubiquitin-specific-processing protease 46; ubiquitin specific peptidase 46
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgtccgaaacatcgcctccatctgtaatatgggcaccaatgcctctgctctggaaaaagacattggtccagagcagtttccaatcaatgaacactatttcggattggtcaattttggaaacacatgctactgtaactccgtgcttcaggcattgtacttctgccgtccattccgggagaatgtgttggcatacaaggcccagcaaaagaagaaggaaaacttgctgacgtgcctggcggaccttttccacagcattgccacacagaagaagaaggttggcgtcatcccaccaaagaagttcatttcaaggctgagaaaagagaatgatctctttgataactacatgcagcaggatgctcatgaatttttaaattatttgctaaacactattgcggacatccttcaggaggagaagaaacaggaaaaacaaaatggaaaattaaaaaatggcaacatgaacgaacctgcggaaaataataaaccagaactcacctgggtccatgagatttttcagggaacgcttaccaatgaaactcgatgcttgaactgtgaaactgttagtagcaaagatgaagattttcttgacctttctgttgatgtggagcagaatacatccattacccactgtctaagagacttcagcaacacagaaacactgtgtagtgaacaaaaatattattgtgaaacatgctgcagcaaacaagaagcccagaaaaggatgagggtaaaaaagctgcccatgatcttggccctgcacctaaagcggttcaagtacatggagcagctgcacagatacaccaagctgtcttaccgtgtggtcttccctctggaactccggctcttcaacacctccagtgatgcagtgaacctggaccgcatgtatgacttggttgcggtggtcgttcactgtggcagtggtcctaatcgtgggcattatatcactattgtgaaaagtcacggcttctggcttttgtttgatgatgacattgtagagaaaatagatgctcaagctattgaagaattctatggcctgacgtcagatatatcaaaaaattcagaatctggatatattttattctatcagtcaagagagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ataxia, cerebellar, Cayman type
- chemokine (C-C motif) receptor 6
- ubiquitin specific peptidase 21
- G protein-coupled receptor 182

Buy USP46-ubiquitin specific peptidase 46 Gene now

Add to cart