ARR3-arrestin 3, retinal (X-arrestin) Gene View larger

ARR3-arrestin 3, retinal (X-arrestin) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARR3-arrestin 3, retinal (X-arrestin) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ARR3-arrestin 3, retinal (X-arrestin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012096
Product type: DNA & cDNA
Ncbi symbol: ARR3
Origin species: Human
Product name: ARR3-arrestin 3, retinal (X-arrestin) Gene
Size: 2ug
Accessions: BC012096
Gene id: 407
Gene description: arrestin 3, retinal (X-arrestin)
Synonyms: ARRX; cArr; arrestin-C; C-arrestin; arrestin 3 retinal (X-arrestin); arrestin 4; retinal cone arrestin-3; arrestin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccaaggtgtttaagaagaccagctccaatgggaagctctccatctacctggggaaacgggacttcgtggaccatgtggacacggtggaacccattgacggtgttgtcctggttgatcctgagtactttaaatgtcgaaagttgtttgtcatgttgacatgtgcctttcgctatggccgtgatgacttggaagtgattggtctgacgttccgaaaagatctgtatgtgcagaccctgcaagtggtcccagctgaatccagcagccctcaggggcccctcacagtcctacaggagcgactactgcacaagctaggggacaatgcctacccctttaccctgcagatggtgaccaacctgccctgttctgtgacactgcagccaggtcctgaagatgcaggaaagccctgtgggattgactttgaagtgaagagtttctgtgctgaaaacccagaggagacagtctccaagagagactatgtgcggctggttgtccggaaagtacaatttgcaccaccggaggcaggccctggcccctcagcccagaccatccgccgcttccttctgtcagctcagcccctacaactccaggcctggatggacagggaggttcactaccacggagaacccatctctgtcaatgtttctatcaacaactgcaccaacaaggtcatcaaaaaaatcaagatttcagttgaccagatcacagatgttgtcctgtattcactagacaagtacaccaagactgtgttcattcaggaattcacggagactgtagctgctaattccagcttctcccagagctttgcagtaaccccaatcctggctgccagctgccagaaacggggcctggcactggatggcaaacttaagcatgaagataccaacctggcctctagcacaattattagaccgggaatggacaaagagctgctggggatcctggtgtcctacaaagtcagagtcaacctgatggtgtcctgtggtggcatcctaggagacctgacagccagcgatgttggtgtggagctacccttggtcctgatccatccgaagccatctcatgaggccgctaggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-acetylneuraminic acid synthase
- ubiquitin specific peptidase 46
- ataxia, cerebellar, Cayman type
- chemokine (C-C motif) receptor 6

Buy ARR3-arrestin 3, retinal (X-arrestin) Gene now

Add to cart