PCMTD1-protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 Gene View larger

PCMTD1-protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 Gene

PTXBC032670

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCMTD1-protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PCMTD1-protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032670
Product type: DNA & cDNA
Ncbi symbol: PCMTD1
Origin species: Human
Product name: PCMTD1-protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 Gene
Size: 2ug
Accessions: BC032670
Gene id: 115294
Gene description: protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Synonyms: protein-L-isoaspartate O-methyltransferase domain-containing protein 1; protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaggagctgtgagtgctggggaagataatgatgacttaattgataatttaaaagaagctcagtatattcgtactgaaagagtggagcaagccttcagagcgattgatcgtggagattactatttggaaggctacagagacaatgcttacaaagacttagcctggaagcatggaaacatccacttgtcagcaccttgcatttattctgaagttatggaagcattgaaacttcaaccaggattgtcttttcttaacctgggaagtggaaccggatatttaagtacaatggtgggcttaattttaggtccttttggaataaatcatgggattgagcttcattcagatgtggtggaatatgccaaggaaaaactggagagcttcatcaaaaatagtgatagctttgataaatttgagttctgtgaacctgcatttgttgttggtaattgcctccagatagcttctgacagtcatcagtatgatcgaatttattgtggagctggagtacagaaagaccatgaaaactacatgaaaatattactaaaagttggaggcatattagtcatgcctatagaggatcagttaacacagattatgcgaactggacagaacacttgggaaagtaaaaatatccttgctgtttcatttgctccacttgtgcaaccaagtaagaatgataatggcaaaccagattctgtgggactccctccctgtgctgtcaggaatctacaggacttggctcgtatttacattcgacgcacacttagaaatttcataaatgatgagatgcaggccaaggggattcctcaaagggctccacccaaaaggaaaagaaagagagttaaacagagaattaacacttacgtatttgtgggtaatcagcttattcctcagcctctagacagtgaagaggatgaaaaaatggaagaggatatcaaagaagaggaggaaaaagatcacaatgaagcaatgaagccagaggagccacctcaaaatttactgagagaaaaaatcatgaagctgcccctccctgaatctttaaaagcttacttgacatattttagagacaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
- hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
- amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
- dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2)

Buy PCMTD1-protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 Gene now

Add to cart