HSD3B2-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 Gene View larger

HSD3B2-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSD3B2-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HSD3B2-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC038419
Product type: DNA & cDNA
Ncbi symbol: HSD3B2
Origin species: Human
Product name: HSD3B2-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 Gene
Size: 2ug
Accessions: BC038419
Gene id: 3284
Gene description: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
Synonyms: HSD3B; HSDB; SDR11E2; 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 2; 3 beta-HSD type II; 3 beta-hydroxysteroid dehydrogenase type II, delta 5-delta 4-isomerase type II, 3 beta-HSD type II; 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type II; 3-beta-HSD II; 3-beta-HSD adrenal and gonadal type; 3-beta-hydroxy-5-ene steroid dehydrogenase; 3-beta-hydroxy-Delta(5)-steroid dehydrogenase; delta 5-delta 4-isomerase type II; progesterone reductase; short chain dehydrogenase/reductase family 11E, member 2; hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctggagctgccttgtgacaggagcaggagggcttctgggtcagaggatcgtccgcctgttggtggaagagaaggaactgaaggagatcagggccttggacaaggccttcagaccagaattgagagaggaattttctaagctccagaacaggaccaagctgactgtacttgaaggagacattctggatgagccattcctgaaaagagcctgccaggacgtctcggtcgtcatccacaccgcctgtatcattgatgtctttggtgtcactcacagagagtccatcatgaatgtcaatgtgaaaggtacccagctactgttggaggcctgtgtccaagccagtgtgccagtcttcatctacaccagtagcatagaggtagccgggcccaactcctacaaggaaatcatccagaacggccacgaagaagagcctctggaaaacacatggcccactccatacccgtacagcaaaaagcttgctgagaaggctgtgctggcggctaatgggtggaatctaaaaaatggtgataccttgtacacttgtgcgttaagacccacatatatctatggggaaggaggcccattcctttctgccagtataaatgaggccctgaacaacaatgggatcctgtcaagtgttggaaagttctctacagtcaacccagtctatgttggcaacgtggcctgggcccacattctggccttgagggctctgcgggaccccaagaaggccccaagtgtccgaggtcaattctattacatctcagatgacacgcctcaccaaagctatgataaccttaattacatcctgagcaaagagtttggcctccgccttgattccagatggagccttcctttaaccctgatgtactggattggcttcctgctggaagtagtgagcttcctactcagcccaatttactcctatcaaccccccttcaaccgccacacagtcacattatcaaatagtgtgttcaccttctcttacaagaaggctcagcgagatctggcgtataagccactctacagctgggaggaagccaagcagaaaaccgtggagtgggttggttcccttgtggaccggcacaaggagaccctgaagtccaagactcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
- dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2)
- solute carrier family 2 (facilitated glucose/fructose transporter), member 5
- amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11

Buy HSD3B2-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 Gene now

Add to cart