ALS2CR11-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 Gene View larger

ALS2CR11-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 Gene

PTXBC030659

New product

Data sheet of ALS2CR11-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALS2CR11-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC030659
Product type: DNA & cDNA
Ncbi symbol: ALS2CR11
Origin species: Human
Product name: ALS2CR11-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 Gene
Size: 2ug
Accessions: BC030659
Gene id: 151254
Gene description: amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11
Synonyms: amyotrophic lateral sclerosis 2 chromosomal region candidate gene 11 protein; amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11; testicular tissue protein Li 16; amyotrophic lateral sclerosis 2 chromosome region candidate 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccaccccaagagacaaataggcctttcagcacacttgataaccgcagcgggcaggtccaagtcctgtccgccaccccgctattgcagaggaatccctacagcagcccggatatcatgcacattaaagggtcggaggcttcttcggtcccttacgccctgaaccagggcacgacggccctgcctaagaacaagaaccaggagggcaccgggcaccggctgctgaacatgctgagaaaaactcttaaagagtctgatagtgaagaactggaaataacacaggagacaccaaatttggtgccatttggggatgtggttggctgcctgggcattcatataaagaactgcagacattttatgcctaagatcagtttacaacattatgctaatttattcattcgcatctctataaacaaagctgtgaaatgtacaaaaatgtgtagcttgctatccaaaaacgatgagaagaacactgtaattaagttcgatgaagtgaagtatttttctgtacaggttcccagacgttatgatgataagcggaataatattttattggaactcatacaatatgacaatagagaaaaacgtgctttcttgttagggagtgttcagatacatctttatgaggtaattcagaaagggtgcttcattgaagaggtccaagtgttgcatggaaacatatttgtctgcaggctggaggtggaatttatgttctcctatggaaactttggttatggattttcacatcagttaaaacctcttcagaaaattactgagccatccatgtttatgaatcttgcaccacctccagaaagaacagatcccgtgacaaaagttattacaccacagacagtagaatatccagcattcttatccccagacctgaatgttactgttgggactccagctgtgcaatcctccaaccagccatctgtagtgcgacttgaaaaacttcagcaacaaccccgggaaaggctggaaaagatgaaaaaagaatatagaaatctgaatacatggatagataaagctaactatttagaaagcattctaatgccaaaattggaacataaggattctgaggaaactaatatagatgaggcatctgaaaacacgaaaagtaatcaacctgaagaggagcttgaaaatattgtaggagtagatatccctcttgtaaatgaggaagctgaaactactgcaaatgagttactggataatgattctgagaaaggcctgactataccaactttgaaccaatcggaccaagataattcaactgctgatgcttctaaaaatgatgaatcaacaccttcacccacagaagtgcactcattgtgcactatttctaaccaggaaacaataaaagcaggcagaataccacctttaggtgaacgtcaatcagaaagcatgccagacagaaaaatgaaaaatgtattttttccattagaagtaaaattaaaagataactatccaagcattttaaaagcagactcatctctatcagaggtggctttttcaccaaaagaatataattcaccatctttcagaccagaatatatagaattcaaaccaaaatttcaggattgttcagataaatttgaggatttacatgacatgacctcatttacacaccttaaaaaagtaaaatcaagatcaaggcttttaggaaaaagctcagatgatatccataaccatgccagacactctgcaagaccatatactgctccggaggttaacaagcaacgagaaagctacagtggaaagtttacaagtcgtcgaatggtttcatcaggcttagttcatataaatgataaaacatcagattatgaaatgcataaaatgcggccaaaaaaaattaaaagaggatattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1
- thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)
- tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain
- MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish))