Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFRSF10C-tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain Gene
PTXBC125041
New product
Data sheet of TNFRSF10C-tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFRSF10C-tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC125041 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFRSF10C |
| Origin species: | Human |
| Product name: | TNFRSF10C-tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain Gene |
| Size: | 2ug |
| Accessions: | BC125041 |
| Gene id: | 8794 |
| Gene description: | tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain |
| Synonyms: | CD263; DCR1; DCR1-TNFR; LIT; TRAIL-R3; TRAILR3; TRID; tumor necrosis factor receptor superfamily member 10C; TNF-related apoptosis-inducing ligand receptor 3; antagonist decoy receptor for TRAIL/Apo-2L; cytotoxic TRAIL receptor-3; decoy TRAIL receptor without death domain; decoy receptor 1; lymphocyte inhibitor of TRAIL; tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain; TNF receptor superfamily member 10c |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccggatccccaagaccctaaagttcgtcgtcgtcatcgtcgcggtcctgctgccagtcctagcttactctgccaccactgcccggcaggaggaagttccccagcagacagtggccccacagcaacagaggcacagcttcaagggggaggagtgtccagcaggatctcatagatcagaacatactggagcctgtaacccgtgcacagagggtgtggattacaccaacgcttccaacaatgaaccttcttgcttcccatgtacagtttgtaaatcagatcaaaaacataaaagttcctgcaccatgaccagagacacagtgtgtcagtgtaaagaaggcaccttccggaatgaaaactccccagagatgtgccggaagtgtagcaggtgccctagtggggaagtccaagtcagtaattgtacgtcctgggatgatatccagtgtgttgaagaatttggtgccaatgccactgtggaaaccccagctgctgaagagacaatgaacaccagcccggggactcctgccccagctgctgaagagacaatgaacaccagcccagggactcctgccccagctgctgaagagacaatgaccaccagcccggggactcctgccccagctgctgaagagacaatgaccaccagcccggggactcctgccccagctgctgaagagacaatgaccaccagcccggggactcctgcctcttctcattacctctcatgcaccatcgtagggatcatagttctaattgtgcttctgattgtgtttgtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) - translation initiation factor eIF-2B subunit alpha/beta/delta-like protein - solute carrier family 10 (sodium/bile acid cotransporter family), member 3 - family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 |