SLC10A3-solute carrier family 10 (sodium/bile acid cotransporter family), member 3 Gene View larger

SLC10A3-solute carrier family 10 (sodium/bile acid cotransporter family), member 3 Gene

PTXBC004966

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC10A3-solute carrier family 10 (sodium/bile acid cotransporter family), member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC10A3-solute carrier family 10 (sodium/bile acid cotransporter family), member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004966
Product type: DNA & cDNA
Ncbi symbol: SLC10A3
Origin species: Human
Product name: SLC10A3-solute carrier family 10 (sodium/bile acid cotransporter family), member 3 Gene
Size: 2ug
Accessions: BC004966
Gene id: 8273
Gene description: solute carrier family 10 (sodium/bile acid cotransporter family), member 3
Synonyms: DXS253E; P3 protein; Protein P3; solute carrier family 10 (sodium/bile acid cotransporter family), member 3; solute carrier family 10 member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgttaatgcaggacaagggcagctctcagcagtggcctggtctggggggcgagggtggtggcacaggtcccttaagcatgctcagagctgccctgctgctcatcagcctgccatggggggcccaagggacagccagcaccagcctcagcactgctgggggtcacaccgtgccaccgactgggggccgctacttgagcattggagatggctctgtgatggagtttgagtttcctgaggacagtgagggcatcatcgtgatctccagccagtacccaggccaggccaacaggacggcgcctggccccatgctcagggtcacctccctggacacagaggtgctgaccatcaagaacctcgtggacgcccatgaggccccgcccacactgattgaggagcggagagacttctgcatcaaggtctcacctgctgaagacacgcctgccaccctcagcgccgacctggcccacttctcggaaaacccaatcctctacctgctcctgcctcttatctttgtcaacaagtgttcgtttgggtgcaaagtggaactcgaggttctgaaggggctcatgcagagcccccagcccatgctgctgggcctcctgggccagtttctggtcatgcccttgtacgctttcctcatggccaaggtcttcatgctgcccaaggccctggctctgggcctcatcatcacctgctcgtcgcctggcggcggggggagctacctcttcagcctccttcttggaggggacgtcaccctggccatctccatgactttcctctctacggtggctgccactggcttcttgcctctgtcttcggccatctacagccgcctgctcagcatccatgagacgctccacgtgcccatctccaagatcctggggaccctgctgttcattgccatccccatagccgtgggcgtgctgatcaagtccaagctccccaagttctcccagctgctgctgcaggtcgtcaagcccttcagctttgtgctcctcctgggcggcctcttcctggcctatcgcatgggggtcttcatcctggcaggcatccggctacccatcgtactggtgggtatcacggtgcccctggttggcctgttggtgggctactgcctagccacgtgtctgaagctgccagtggcccagcggcggacggtcagcattgaggtaggggtgcagaacagcctgctggccttggccatgctgcagctatccctccgccgccttcaagctgactatgcctcccaggcccccttcattgtggcgctgagcggcacctccgagatgctggccttggtcattggccacttcatctacagcagcctgttcccagttccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
- TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
- solute carrier family 25 (carnitine/acylcarnitine translocase), member 20
- protein kinase, interferon-inducible double stranded RNA dependent activator

Buy SLC10A3-solute carrier family 10 (sodium/bile acid cotransporter family), member 3 Gene now

Add to cart