Login to display prices
Login to display prices
PRKRA-protein kinase, interferon-inducible double stranded RNA dependent activator Gene View larger

PRKRA-protein kinase, interferon-inducible double stranded RNA dependent activator Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRKRA-protein kinase, interferon-inducible double stranded RNA dependent activator Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRKRA-protein kinase, interferon-inducible double stranded RNA dependent activator Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009470
Product type: DNA & cDNA
Ncbi symbol: PRKRA
Origin species: Human
Product name: PRKRA-protein kinase, interferon-inducible double stranded RNA dependent activator Gene
Size: 2ug
Accessions: BC009470
Gene id: 8575
Gene description: protein kinase, interferon-inducible double stranded RNA dependent activator
Synonyms: DYT16; HSD14; RAX; interferon-inducible double-stranded RNA-dependent protein kinase activator A; PKR-associated protein X; PKR-associating protein X; protein activator of the interferon-induced protein kinase; protein kinase, interferon-inducible double-stranded RNA-dependent activator; protein activator of interferon induced protein kinase EIF2AK2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccagagcaggcaccgcgccgaggccccgccgctggagcgcgaggacagtgggaccttcagtttggggaagatgataacagctaagccagggaaaacaccgattcaggtattacacgaatacggcatgaagaccaagaacatcccagtttatgaatgtgaaagatctgatgtgcaaatacacgtgcccactttcaccttcagagtaaccgttggtgacataacctgcacaggtgaaggtacaagtaagaagctggcgaaacatagagctgcagaggctgccataaacattttgaaagccaatgcaagtatttgctttgcagttcctgaccccttaatgcctgacccttccaagcaaccaaagaaccagcttaatcctattggttcattacaggaattggctattcatcatggctggagacttcctgaatataccctttcccaggagggaggacctgctcataagagagaatatactacaatttgcaggctagagtcatttatggaaactggaaagggggcatcaaaaaagcaagccaaaaggaatgctgctgagaaatttcttgccaaatttagtaatatttctccagagaaccacatttctttaacaaatgtagtaggacattctttaggatgtacttggcattccttgaggaattctcctggtgaaaagatcaacttactgaaaagaagcctccttagtattccaaatacagattacatccagctgcttagtgaaattgccaaggaacaaggttttaatataacatatttggatatagatgaactgagcgccaatggacaatatcaatgtcttgctgaactgtccaccagccccatcacagtctgtcatggctccggtatctcctgtggcaatgcacaaagtgatgcagctcacaatgctttgcagtatttaaagataatagcagaaagaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
- runt-related transcription factor 1; translocated to, 1 (cyclin D-related)
- serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2
- 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)