Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene
PTXBC001689
New product
Data sheet of SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001689 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A20 |
| Origin species: | Human |
| Product name: | SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene |
| Size: | 2ug |
| Accessions: | BC001689 |
| Gene id: | 788 |
| Gene description: | solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
| Synonyms: | CAC; CACT; mitochondrial carnitine/acylcarnitine carrier protein; solute carrier family 25 (carnitine/acylcarnitine translocase), member 20; solute carrier family 25 member 20 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgaccagccaaaacccatcagcccgctcaagaacctgctggccggcggctttggcggcgtgtgcctggtgttcgtcggtcaccctctggacacggtcaaggtccgactgcagacacagccaccgagtttgcctggacaacctcccatgtactctgggacctttgactgtttccggaagactctttttagagagggcatcacggggctatatcggggaatggctgcccctatcatcggggtcactcccatgtttgccgtgtgcttctttgggtttggtttggggaagaaactacaacagaaacacccagaagatgtgctcagctatccccagctttttgcagctgggatgttatctggcgtattcaccacaggaatcatgactcctggagaacggatcaagtgcttattacagattcaggcttcttcaggagaaagcaagtacactggtaccttggactgtgcaaagaagctgtaccaggagtttgggatccgaggcatctacaaagggactgtgcttacccttatgcgagatgtcccagctagtggaatgtatttcatgacatatgaatggctgaaaaatatcttcactccggagggaaagagggtcagtgagctcagtgcccctcggatcttggtggctgggggcattgcagggatcttcaactgggctgtggcaatccccccagatgtgctcaagtctcgattccagactgcacctcctgggaaatatcctaatggtttcagagatgtgctgagggagctgatccgggatgaaggagtcacatccttgtacaaagggttcaatgcagtgatgatccgagccttcccagccaatgcggcctgtttccttggctttgaagttgccatgaagttccttaattgggccacccccaacttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein kinase, interferon-inducible double stranded RNA dependent activator - TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa - runt-related transcription factor 1; translocated to, 1 (cyclin D-related) - serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 |