Login to display prices
Login to display prices
SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene View larger

SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene

PTXBC001689

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene

Proteogenix catalog: PTXBC001689
Ncbi symbol: SLC25A20
Product name: SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene
Size: 2ug
Accessions: BC001689
Gene id: 788
Gene description: solute carrier family 25 (carnitine/acylcarnitine translocase), member 20
Synonyms: CAC; CACT; mitochondrial carnitine/acylcarnitine carrier protein; solute carrier family 25 (carnitine/acylcarnitine translocase), member 20; solute carrier family 25 member 20
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgaccagccaaaacccatcagcccgctcaagaacctgctggccggcggctttggcggcgtgtgcctggtgttcgtcggtcaccctctggacacggtcaaggtccgactgcagacacagccaccgagtttgcctggacaacctcccatgtactctgggacctttgactgtttccggaagactctttttagagagggcatcacggggctatatcggggaatggctgcccctatcatcggggtcactcccatgtttgccgtgtgcttctttgggtttggtttggggaagaaactacaacagaaacacccagaagatgtgctcagctatccccagctttttgcagctgggatgttatctggcgtattcaccacaggaatcatgactcctggagaacggatcaagtgcttattacagattcaggcttcttcaggagaaagcaagtacactggtaccttggactgtgcaaagaagctgtaccaggagtttgggatccgaggcatctacaaagggactgtgcttacccttatgcgagatgtcccagctagtggaatgtatttcatgacatatgaatggctgaaaaatatcttcactccggagggaaagagggtcagtgagctcagtgcccctcggatcttggtggctgggggcattgcagggatcttcaactgggctgtggcaatccccccagatgtgctcaagtctcgattccagactgcacctcctgggaaatatcctaatggtttcagagatgtgctgagggagctgatccgggatgaaggagtcacatccttgtacaaagggttcaatgcagtgatgatccgagccttcccagccaatgcggcctgtttccttggctttgaagttgccatgaagttccttaattgggccacccccaacttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: