SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene View larger

SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001689
Product type: DNA & cDNA
Ncbi symbol: SLC25A20
Origin species: Human
Product name: SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene
Size: 2ug
Accessions: BC001689
Gene id: 788
Gene description: solute carrier family 25 (carnitine/acylcarnitine translocase), member 20
Synonyms: CAC; CACT; mitochondrial carnitine/acylcarnitine carrier protein; solute carrier family 25 (carnitine/acylcarnitine translocase), member 20; solute carrier family 25 member 20
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgaccagccaaaacccatcagcccgctcaagaacctgctggccggcggctttggcggcgtgtgcctggtgttcgtcggtcaccctctggacacggtcaaggtccgactgcagacacagccaccgagtttgcctggacaacctcccatgtactctgggacctttgactgtttccggaagactctttttagagagggcatcacggggctatatcggggaatggctgcccctatcatcggggtcactcccatgtttgccgtgtgcttctttgggtttggtttggggaagaaactacaacagaaacacccagaagatgtgctcagctatccccagctttttgcagctgggatgttatctggcgtattcaccacaggaatcatgactcctggagaacggatcaagtgcttattacagattcaggcttcttcaggagaaagcaagtacactggtaccttggactgtgcaaagaagctgtaccaggagtttgggatccgaggcatctacaaagggactgtgcttacccttatgcgagatgtcccagctagtggaatgtatttcatgacatatgaatggctgaaaaatatcttcactccggagggaaagagggtcagtgagctcagtgcccctcggatcttggtggctgggggcattgcagggatcttcaactgggctgtggcaatccccccagatgtgctcaagtctcgattccagactgcacctcctgggaaatatcctaatggtttcagagatgtgctgagggagctgatccgggatgaaggagtcacatccttgtacaaagggttcaatgcagtgatgatccgagccttcccagccaatgcggcctgtttccttggctttgaagttgccatgaagttccttaattgggccacccccaacttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein kinase, interferon-inducible double stranded RNA dependent activator
- TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa
- runt-related transcription factor 1; translocated to, 1 (cyclin D-related)
- serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2

Buy SLC25A20-solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 Gene now

Add to cart