Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MGC3207-translation initiation factor eIF-2B subunit alpha/beta/delta-like protein Gene
PTXBC001703
New product
Data sheet of MGC3207-translation initiation factor eIF-2B subunit alpha/beta/delta-like protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MGC3207-translation initiation factor eIF-2B subunit alpha/beta/delta-like protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001703 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGC3207 |
| Origin species: | Human |
| Product name: | MGC3207-translation initiation factor eIF-2B subunit alpha/beta/delta-like protein Gene |
| Size: | 2ug |
| Accessions: | BC001703 |
| Gene id: | 84245 |
| Gene description: | translation initiation factor eIF-2B subunit alpha/beta/delta-like protein |
| Synonyms: | M1Pi; MRDI; MTNA; Ypr118w; methylthioribose-1-phosphate isomerase; MTR-1-P isomerase; S-methyl-5-thioribose-1-phosphate isomerase 1; mediator of RhoA-dependent invasion; methylthioribose-1-phosphate isomerase homolog; translation initiation factor eIF-2B subunit alpha/beta/delta-like protein; methylthioribose-1-phosphate isomerase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccctggaggcgatccgctactcgcggggctccctgcagatcctagaccagctgctgctgcccaagcagagccgctacgaggcggtgggctcggtgcaccaggcctgggaggccatccgcgccatgaaggtgcggggcgccccggccatagccctggtgggctgtctcagcctcgccgtggagctgcaggcgggcgccgggggaccgggactcgccgcgctcgtggccttcgtgcgcgacaagctgagcttcctcgtcaccgcccggcccaccgctgtcaacatggcccgcgccgcccgcgacctggctgatgttgcagcccgggaggccgaacgggagggcgctacggaagaggcggtccgggagagagtgatctgctgcaccgaggacatgctggagaaagacctcagagacaaccgaagcattggggacctaggagcccgccacctcctggagcgggtggcccccagcggtggcaaggtgactgtgctgacccactgtaacactggtgctctggccaccgctggctatggtacagccctaggtgtgattcgctcactgcacagcctgggccgcctggagcatgccttctgcacagagacccggccctacaaccagggagcccggctgacggcctttgagctggtctatgagcagatccccgccacccttatcaccgacagcatggtggctgctgccatggcccataggggcgtgtcagctgtggtcgtgggagctgaccgcgtggttgccaacggcgacacagccaacaaggtgggcacctaccagctggccattgtcgccaagcaccatggcattcccttctacgtggctgcccccagctcttcatgtgacctccgtctggagaccggcaaggagatcattattgaagagcgaccgggccaggagctgaccgatgttaatggggtccggattgcagcacctgggattggagtttggaatcctgccttcgatgtcaccccccacgacctcatcactggtggcatcatcacagaactgggggtctttgcccctgaggagctccggacagccctaaccaccaccatctcttccagggatggaaccctagatggaccccagatgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 10 (sodium/bile acid cotransporter family), member 3 - family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 - TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa - solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |