MGC3207-translation initiation factor eIF-2B subunit alpha/beta/delta-like protein Gene View larger

MGC3207-translation initiation factor eIF-2B subunit alpha/beta/delta-like protein Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC3207-translation initiation factor eIF-2B subunit alpha/beta/delta-like protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MGC3207-translation initiation factor eIF-2B subunit alpha/beta/delta-like protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001703
Product type: DNA & cDNA
Ncbi symbol: MGC3207
Origin species: Human
Product name: MGC3207-translation initiation factor eIF-2B subunit alpha/beta/delta-like protein Gene
Size: 2ug
Accessions: BC001703
Gene id: 84245
Gene description: translation initiation factor eIF-2B subunit alpha/beta/delta-like protein
Synonyms: M1Pi; MRDI; MTNA; Ypr118w; methylthioribose-1-phosphate isomerase; MTR-1-P isomerase; S-methyl-5-thioribose-1-phosphate isomerase 1; mediator of RhoA-dependent invasion; methylthioribose-1-phosphate isomerase homolog; translation initiation factor eIF-2B subunit alpha/beta/delta-like protein; methylthioribose-1-phosphate isomerase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccctggaggcgatccgctactcgcggggctccctgcagatcctagaccagctgctgctgcccaagcagagccgctacgaggcggtgggctcggtgcaccaggcctgggaggccatccgcgccatgaaggtgcggggcgccccggccatagccctggtgggctgtctcagcctcgccgtggagctgcaggcgggcgccgggggaccgggactcgccgcgctcgtggccttcgtgcgcgacaagctgagcttcctcgtcaccgcccggcccaccgctgtcaacatggcccgcgccgcccgcgacctggctgatgttgcagcccgggaggccgaacgggagggcgctacggaagaggcggtccgggagagagtgatctgctgcaccgaggacatgctggagaaagacctcagagacaaccgaagcattggggacctaggagcccgccacctcctggagcgggtggcccccagcggtggcaaggtgactgtgctgacccactgtaacactggtgctctggccaccgctggctatggtacagccctaggtgtgattcgctcactgcacagcctgggccgcctggagcatgccttctgcacagagacccggccctacaaccagggagcccggctgacggcctttgagctggtctatgagcagatccccgccacccttatcaccgacagcatggtggctgctgccatggcccataggggcgtgtcagctgtggtcgtgggagctgaccgcgtggttgccaacggcgacacagccaacaaggtgggcacctaccagctggccattgtcgccaagcaccatggcattcccttctacgtggctgcccccagctcttcatgtgacctccgtctggagaccggcaaggagatcattattgaagagcgaccgggccaggagctgaccgatgttaatggggtccggattgcagcacctgggattggagtttggaatcctgccttcgatgtcaccccccacgacctcatcactggtggcatcatcacagaactgggggtctttgcccctgaggagctccggacagccctaaccaccaccatctcttccagggatggaaccctagatggaccccagatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 10 (sodium/bile acid cotransporter family), member 3
- family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
- TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa
- solute carrier family 25 (carnitine/acylcarnitine translocase), member 20

Buy MGC3207-translation initiation factor eIF-2B subunit alpha/beta/delta-like protein Gene now

Add to cart